ID: 1201047873

View in Genome Browser
Species Human (GRCh38)
Location Y:9906114-9906136
Sequence TAACGGCATTGGGCTGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201047873_1201047879 16 Left 1201047873 Y:9906114-9906136 CCTTTTTCAGCCCAATGCCGTTA No data
Right 1201047879 Y:9906153-9906175 CACTCTCTGTCTTTCTCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201047873 Original CRISPR TAACGGCATTGGGCTGAAAA AGG (reversed) Intergenic
No off target data available for this crispr