ID: 1201047876

View in Genome Browser
Species Human (GRCh38)
Location Y:9906125-9906147
Sequence ATCCAGGACATTAACGGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201047876_1201047879 5 Left 1201047876 Y:9906125-9906147 CCAATGCCGTTAATGTCCTGGAT No data
Right 1201047879 Y:9906153-9906175 CACTCTCTGTCTTTCTCTCAAGG No data
1201047876_1201047880 26 Left 1201047876 Y:9906125-9906147 CCAATGCCGTTAATGTCCTGGAT No data
Right 1201047880 Y:9906174-9906196 GGAATTTCTACATGTATGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201047876 Original CRISPR ATCCAGGACATTAACGGCAT TGG (reversed) Intergenic
No off target data available for this crispr