ID: 1201049487

View in Genome Browser
Species Human (GRCh38)
Location Y:9918060-9918082
Sequence AAGTGTGGCCAAATGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201049480_1201049487 19 Left 1201049480 Y:9918018-9918040 CCAAGGTTTTGAGCCTTACTCTG No data
Right 1201049487 Y:9918060-9918082 AAGTGTGGCCAAATGGAAGTGGG No data
1201049483_1201049487 6 Left 1201049483 Y:9918031-9918053 CCTTACTCTGAGGCTGTGGCAGA No data
Right 1201049487 Y:9918060-9918082 AAGTGTGGCCAAATGGAAGTGGG No data
1201049479_1201049487 23 Left 1201049479 Y:9918014-9918036 CCTACCAAGGTTTTGAGCCTTAC No data
Right 1201049487 Y:9918060-9918082 AAGTGTGGCCAAATGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201049487 Original CRISPR AAGTGTGGCCAAATGGAAGT GGG Intergenic
No off target data available for this crispr