ID: 1201050382

View in Genome Browser
Species Human (GRCh38)
Location Y:9926910-9926932
Sequence CTGTTATTATAGCTATATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201050382_1201050389 29 Left 1201050382 Y:9926910-9926932 CCAGGATATAGCTATAATAACAG No data
Right 1201050389 Y:9926962-9926984 TGATTCCGTAGTTCAGCAACAGG No data
1201050382_1201050386 4 Left 1201050382 Y:9926910-9926932 CCAGGATATAGCTATAATAACAG No data
Right 1201050386 Y:9926937-9926959 ACTCCAGTGTTCAGCTGTATTGG No data
1201050382_1201050387 5 Left 1201050382 Y:9926910-9926932 CCAGGATATAGCTATAATAACAG No data
Right 1201050387 Y:9926938-9926960 CTCCAGTGTTCAGCTGTATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201050382 Original CRISPR CTGTTATTATAGCTATATCC TGG (reversed) Intergenic
No off target data available for this crispr