ID: 1201054616

View in Genome Browser
Species Human (GRCh38)
Location Y:9976164-9976186
Sequence GACTTGGATGTCTCAACACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201054608_1201054616 22 Left 1201054608 Y:9976119-9976141 CCCCTTTCTAACAATGGCCACTC No data
Right 1201054616 Y:9976164-9976186 GACTTGGATGTCTCAACACCTGG No data
1201054613_1201054616 -9 Left 1201054613 Y:9976150-9976172 CCTCCACTACCTCTGACTTGGAT No data
Right 1201054616 Y:9976164-9976186 GACTTGGATGTCTCAACACCTGG No data
1201054611_1201054616 5 Left 1201054611 Y:9976136-9976158 CCACTCTTGTTATTCCTCCACTA No data
Right 1201054616 Y:9976164-9976186 GACTTGGATGTCTCAACACCTGG No data
1201054610_1201054616 20 Left 1201054610 Y:9976121-9976143 CCTTTCTAACAATGGCCACTCTT No data
Right 1201054616 Y:9976164-9976186 GACTTGGATGTCTCAACACCTGG No data
1201054609_1201054616 21 Left 1201054609 Y:9976120-9976142 CCCTTTCTAACAATGGCCACTCT No data
Right 1201054616 Y:9976164-9976186 GACTTGGATGTCTCAACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201054616 Original CRISPR GACTTGGATGTCTCAACACC TGG Intergenic
No off target data available for this crispr