ID: 1201055253

View in Genome Browser
Species Human (GRCh38)
Location Y:9982545-9982567
Sequence TTTTTCAGCTTGTAAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201055253_1201055254 -9 Left 1201055253 Y:9982545-9982567 CCTGTTTTTTACAAGCTGAAAAA No data
Right 1201055254 Y:9982559-9982581 GCTGAAAAATCATCCCTACTTGG No data
1201055253_1201055255 -2 Left 1201055253 Y:9982545-9982567 CCTGTTTTTTACAAGCTGAAAAA No data
Right 1201055255 Y:9982566-9982588 AATCATCCCTACTTGGTCCCAGG No data
1201055253_1201055260 25 Left 1201055253 Y:9982545-9982567 CCTGTTTTTTACAAGCTGAAAAA No data
Right 1201055260 Y:9982593-9982615 CTATATATAAAAAATAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201055253 Original CRISPR TTTTTCAGCTTGTAAAAAAC AGG (reversed) Intergenic
No off target data available for this crispr