ID: 1201059221

View in Genome Browser
Species Human (GRCh38)
Location Y:10029510-10029532
Sequence TTGTACCTTTAGGAGAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201059218_1201059221 -9 Left 1201059218 Y:10029496-10029518 CCAGGCAAATTTTTTTGTACCTT No data
Right 1201059221 Y:10029510-10029532 TTGTACCTTTAGGAGAGACAGGG No data
1201059213_1201059221 28 Left 1201059213 Y:10029459-10029481 CCTGAGTAGCTGGGATTACAGGT 0: 29735
1: 147997
2: 251626
3: 208111
4: 212677
Right 1201059221 Y:10029510-10029532 TTGTACCTTTAGGAGAGACAGGG No data
1201059217_1201059221 -8 Left 1201059217 Y:10029495-10029517 CCCAGGCAAATTTTTTTGTACCT No data
Right 1201059221 Y:10029510-10029532 TTGTACCTTTAGGAGAGACAGGG No data
1201059216_1201059221 -3 Left 1201059216 Y:10029490-10029512 CCACGCCCAGGCAAATTTTTTTG No data
Right 1201059221 Y:10029510-10029532 TTGTACCTTTAGGAGAGACAGGG No data
1201059215_1201059221 0 Left 1201059215 Y:10029487-10029509 CCACCACGCCCAGGCAAATTTTT No data
Right 1201059221 Y:10029510-10029532 TTGTACCTTTAGGAGAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201059221 Original CRISPR TTGTACCTTTAGGAGAGACA GGG Intergenic
No off target data available for this crispr