ID: 1201059809

View in Genome Browser
Species Human (GRCh38)
Location Y:10035940-10035962
Sequence ATGCACATGGGGCATCAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201059809_1201059813 -4 Left 1201059809 Y:10035940-10035962 CCAATCTGATGCCCCATGTGCAT No data
Right 1201059813 Y:10035959-10035981 GCATTGACTTTCTAGCGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201059809 Original CRISPR ATGCACATGGGGCATCAGAT TGG (reversed) Intergenic
No off target data available for this crispr