ID: 1201059813

View in Genome Browser
Species Human (GRCh38)
Location Y:10035959-10035981
Sequence GCATTGACTTTCTAGCGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201059804_1201059813 29 Left 1201059804 Y:10035907-10035929 CCTGGGCACACGGGAGGCCAGCC No data
Right 1201059813 Y:10035959-10035981 GCATTGACTTTCTAGCGAAGAGG No data
1201059806_1201059813 12 Left 1201059806 Y:10035924-10035946 CCAGCCGCCATGGTCGCCAATCT No data
Right 1201059813 Y:10035959-10035981 GCATTGACTTTCTAGCGAAGAGG No data
1201059807_1201059813 8 Left 1201059807 Y:10035928-10035950 CCGCCATGGTCGCCAATCTGATG No data
Right 1201059813 Y:10035959-10035981 GCATTGACTTTCTAGCGAAGAGG No data
1201059808_1201059813 5 Left 1201059808 Y:10035931-10035953 CCATGGTCGCCAATCTGATGCCC No data
Right 1201059813 Y:10035959-10035981 GCATTGACTTTCTAGCGAAGAGG No data
1201059803_1201059813 30 Left 1201059803 Y:10035906-10035928 CCCTGGGCACACGGGAGGCCAGC No data
Right 1201059813 Y:10035959-10035981 GCATTGACTTTCTAGCGAAGAGG No data
1201059809_1201059813 -4 Left 1201059809 Y:10035940-10035962 CCAATCTGATGCCCCATGTGCAT No data
Right 1201059813 Y:10035959-10035981 GCATTGACTTTCTAGCGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201059813 Original CRISPR GCATTGACTTTCTAGCGAAG AGG Intergenic
No off target data available for this crispr