ID: 1201062067

View in Genome Browser
Species Human (GRCh38)
Location Y:10055119-10055141
Sequence GGTCTAGGGGACCAGAGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201062067_1201062074 28 Left 1201062067 Y:10055119-10055141 CCAATGCTCTGGTCCCCTAGACC No data
Right 1201062074 Y:10055170-10055192 TCGAATTCCTTTGTCTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201062067 Original CRISPR GGTCTAGGGGACCAGAGCAT TGG (reversed) Intergenic