ID: 1201062068

View in Genome Browser
Species Human (GRCh38)
Location Y:10055132-10055154
Sequence AGTTTAAAAGGTGGGTCTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201062068_1201062076 22 Left 1201062068 Y:10055132-10055154 CCCCTAGACCCACCTTTTAAACT No data
Right 1201062076 Y:10055177-10055199 CCTTTGTCTCCACTGGACTCAGG No data
1201062068_1201062077 23 Left 1201062068 Y:10055132-10055154 CCCCTAGACCCACCTTTTAAACT No data
Right 1201062077 Y:10055178-10055200 CTTTGTCTCCACTGGACTCAGGG No data
1201062068_1201062074 15 Left 1201062068 Y:10055132-10055154 CCCCTAGACCCACCTTTTAAACT No data
Right 1201062074 Y:10055170-10055192 TCGAATTCCTTTGTCTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201062068 Original CRISPR AGTTTAAAAGGTGGGTCTAG GGG (reversed) Intergenic
No off target data available for this crispr