ID: 1201062072

View in Genome Browser
Species Human (GRCh38)
Location Y:10055141-10055163
Sequence CAGAATAAGAGTTTAAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201062072_1201062081 28 Left 1201062072 Y:10055141-10055163 CCACCTTTTAAACTCTTATTCTG No data
Right 1201062081 Y:10055192-10055214 GACTCAGGGTACCTGCTGGGTGG No data
1201062072_1201062076 13 Left 1201062072 Y:10055141-10055163 CCACCTTTTAAACTCTTATTCTG No data
Right 1201062076 Y:10055177-10055199 CCTTTGTCTCCACTGGACTCAGG No data
1201062072_1201062080 25 Left 1201062072 Y:10055141-10055163 CCACCTTTTAAACTCTTATTCTG No data
Right 1201062080 Y:10055189-10055211 CTGGACTCAGGGTACCTGCTGGG No data
1201062072_1201062077 14 Left 1201062072 Y:10055141-10055163 CCACCTTTTAAACTCTTATTCTG No data
Right 1201062077 Y:10055178-10055200 CTTTGTCTCCACTGGACTCAGGG No data
1201062072_1201062079 24 Left 1201062072 Y:10055141-10055163 CCACCTTTTAAACTCTTATTCTG No data
Right 1201062079 Y:10055188-10055210 ACTGGACTCAGGGTACCTGCTGG No data
1201062072_1201062074 6 Left 1201062072 Y:10055141-10055163 CCACCTTTTAAACTCTTATTCTG No data
Right 1201062074 Y:10055170-10055192 TCGAATTCCTTTGTCTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201062072 Original CRISPR CAGAATAAGAGTTTAAAAGG TGG (reversed) Intergenic