ID: 1201062073

View in Genome Browser
Species Human (GRCh38)
Location Y:10055144-10055166
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201062073_1201062077 11 Left 1201062073 Y:10055144-10055166 CCTTTTAAACTCTTATTCTGTCT No data
Right 1201062077 Y:10055178-10055200 CTTTGTCTCCACTGGACTCAGGG No data
1201062073_1201062076 10 Left 1201062073 Y:10055144-10055166 CCTTTTAAACTCTTATTCTGTCT No data
Right 1201062076 Y:10055177-10055199 CCTTTGTCTCCACTGGACTCAGG No data
1201062073_1201062080 22 Left 1201062073 Y:10055144-10055166 CCTTTTAAACTCTTATTCTGTCT No data
Right 1201062080 Y:10055189-10055211 CTGGACTCAGGGTACCTGCTGGG No data
1201062073_1201062079 21 Left 1201062073 Y:10055144-10055166 CCTTTTAAACTCTTATTCTGTCT No data
Right 1201062079 Y:10055188-10055210 ACTGGACTCAGGGTACCTGCTGG No data
1201062073_1201062074 3 Left 1201062073 Y:10055144-10055166 CCTTTTAAACTCTTATTCTGTCT No data
Right 1201062074 Y:10055170-10055192 TCGAATTCCTTTGTCTCCACTGG No data
1201062073_1201062081 25 Left 1201062073 Y:10055144-10055166 CCTTTTAAACTCTTATTCTGTCT No data
Right 1201062081 Y:10055192-10055214 GACTCAGGGTACCTGCTGGGTGG No data
1201062073_1201062082 30 Left 1201062073 Y:10055144-10055166 CCTTTTAAACTCTTATTCTGTCT No data
Right 1201062082 Y:10055197-10055219 AGGGTACCTGCTGGGTGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201062073 Original CRISPR AGACAGAATAAGAGTTTAAA AGG (reversed) Intergenic
No off target data available for this crispr