ID: 1201062076

View in Genome Browser
Species Human (GRCh38)
Location Y:10055177-10055199
Sequence CCTTTGTCTCCACTGGACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201062068_1201062076 22 Left 1201062068 Y:10055132-10055154 CCCCTAGACCCACCTTTTAAACT No data
Right 1201062076 Y:10055177-10055199 CCTTTGTCTCCACTGGACTCAGG No data
1201062071_1201062076 14 Left 1201062071 Y:10055140-10055162 CCCACCTTTTAAACTCTTATTCT No data
Right 1201062076 Y:10055177-10055199 CCTTTGTCTCCACTGGACTCAGG No data
1201062070_1201062076 20 Left 1201062070 Y:10055134-10055156 CCTAGACCCACCTTTTAAACTCT No data
Right 1201062076 Y:10055177-10055199 CCTTTGTCTCCACTGGACTCAGG No data
1201062069_1201062076 21 Left 1201062069 Y:10055133-10055155 CCCTAGACCCACCTTTTAAACTC No data
Right 1201062076 Y:10055177-10055199 CCTTTGTCTCCACTGGACTCAGG No data
1201062072_1201062076 13 Left 1201062072 Y:10055141-10055163 CCACCTTTTAAACTCTTATTCTG No data
Right 1201062076 Y:10055177-10055199 CCTTTGTCTCCACTGGACTCAGG No data
1201062073_1201062076 10 Left 1201062073 Y:10055144-10055166 CCTTTTAAACTCTTATTCTGTCT No data
Right 1201062076 Y:10055177-10055199 CCTTTGTCTCCACTGGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201062076 Original CRISPR CCTTTGTCTCCACTGGACTC AGG Intergenic