ID: 1201062079

View in Genome Browser
Species Human (GRCh38)
Location Y:10055188-10055210
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201062071_1201062079 25 Left 1201062071 Y:10055140-10055162 CCCACCTTTTAAACTCTTATTCT No data
Right 1201062079 Y:10055188-10055210 ACTGGACTCAGGGTACCTGCTGG No data
1201062072_1201062079 24 Left 1201062072 Y:10055141-10055163 CCACCTTTTAAACTCTTATTCTG No data
Right 1201062079 Y:10055188-10055210 ACTGGACTCAGGGTACCTGCTGG No data
1201062073_1201062079 21 Left 1201062073 Y:10055144-10055166 CCTTTTAAACTCTTATTCTGTCT No data
Right 1201062079 Y:10055188-10055210 ACTGGACTCAGGGTACCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201062079 Original CRISPR ACTGGACTCAGGGTACCTGC TGG Intergenic