ID: 1201063521

View in Genome Browser
Species Human (GRCh38)
Location Y:10069010-10069032
Sequence CAGGATAGAGTCTCTGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201063521_1201063525 -4 Left 1201063521 Y:10069010-10069032 CCTCCTGCAGAGACTCTATCCTG 0: 1
1: 0
2: 1
3: 24
4: 184
Right 1201063525 Y:10069029-10069051 CCTGAAAATGGTGCCCTCTTTGG 0: 1
1: 0
2: 1
3: 22
4: 164
1201063521_1201063526 -3 Left 1201063521 Y:10069010-10069032 CCTCCTGCAGAGACTCTATCCTG 0: 1
1: 0
2: 1
3: 24
4: 184
Right 1201063526 Y:10069030-10069052 CTGAAAATGGTGCCCTCTTTGGG 0: 1
1: 0
2: 2
3: 14
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201063521 Original CRISPR CAGGATAGAGTCTCTGCAGG AGG (reversed) Intergenic
900291100 1:1924024-1924046 CAGGACAGGGGCTCTGCAGGGGG - Intronic
900596024 1:3480551-3480573 CAGGATGGAGCGTCTGCGGGTGG + Exonic
901773120 1:11540984-11541006 CAGGATAGACTCTCAGAAGCAGG - Intergenic
902771871 1:18649814-18649836 CAGGCTAGGGCCTCTGCATGGGG - Intronic
904348980 1:29892751-29892773 AAGGATAAAGTCTTTGTAGGTGG - Intergenic
905731161 1:40300396-40300418 AAGGACAGAGGCTCTGGAGGGGG - Intergenic
906996188 1:50796729-50796751 CTAGATAGAGTGACTGCAGGAGG - Intronic
907940662 1:59084197-59084219 CAGGATACAGTCTTTGCCAGGGG - Intergenic
908097251 1:60751936-60751958 CAGGCCTGAGTGTCTGCAGGGGG - Intergenic
912718461 1:111999936-111999958 AAGGATAGAGTCCCTGCAGAAGG - Intergenic
914241076 1:145853595-145853617 CAGCATCGAAGCTCTGCAGGTGG + Exonic
914938098 1:151998226-151998248 AAGGATAGTGTCTTAGCAGGAGG + Intergenic
920079019 1:203358684-203358706 CAGGTCAGAATCTCTGCAGACGG + Intergenic
920347363 1:205314930-205314952 CTGGAAGGAGTCTCTGCATGGGG + Intronic
921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG + Intronic
1066199674 10:33132799-33132821 CAGGAGAGAGAAACTGCAGGTGG - Intergenic
1067668735 10:48300812-48300834 GAGTTAAGAGTCTCTGCAGGTGG - Intergenic
1069877806 10:71573906-71573928 CAGGAGAGAGGCTCTGCAAGAGG - Intronic
1071463197 10:85917932-85917954 CAGGAGAGAGGCTCTGGATGGGG - Intronic
1071721405 10:88150179-88150201 GAGGCCAGAGTCTCTGGAGGTGG - Intergenic
1074293102 10:112156196-112156218 CAGCAGAGATTCTCTGCATGAGG - Intronic
1074389861 10:113048033-113048055 CAGGATCTTGACTCTGCAGGGGG + Intronic
1075311959 10:121421826-121421848 CAGGAATGGGTCTCAGCAGGTGG + Intergenic
1075940951 10:126389501-126389523 CAGGATGGAATTTCTGCAGGTGG - Intergenic
1076045350 10:127289462-127289484 CATGATAGATTCTTTGCAGTGGG + Intronic
1077545330 11:3166724-3166746 CAGGAGAGGGTCTGTGCAGCTGG + Intronic
1083632217 11:64101702-64101724 GAGGACAGAGTCCCTGCACGCGG - Intronic
1084771867 11:71348574-71348596 AAGGAACGAGTCTCTGGAGGTGG - Intergenic
1085013335 11:73156585-73156607 CAGGGGAGACTTTCTGCAGGAGG + Intergenic
1090029601 11:123195477-123195499 TAGGATTGATTCTTTGCAGGAGG + Intergenic
1090263994 11:125342756-125342778 CATGATAGTGTCTCTGGGGGAGG + Intronic
1092974791 12:13734276-13734298 GAGGATAGTGACTCTGCAGGTGG + Intronic
1096188313 12:49598598-49598620 CAGGATAAAGCCTCTGCACCAGG - Intronic
1097230121 12:57505834-57505856 CAGGAGTGAGTCACTGCATGTGG - Intronic
1100527976 12:95437910-95437932 AATGTTAGAATCTCTGCAGGTGG + Intergenic
1101046406 12:100810591-100810613 CAGGATAGTGATTCTGGAGGTGG + Intronic
1101817610 12:108157812-108157834 CAGGAGATAGTGTTTGCAGGAGG - Intronic
1101859201 12:108468792-108468814 CAGGATAAAGACTCTACATGGGG + Intergenic
1102793461 12:115668064-115668086 CAGGGAAGAGTCTCTGGAGTTGG - Intergenic
1105061505 12:133155724-133155746 CAGGAGAGAGTCTCTGAAAGTGG + Exonic
1109446169 13:62443716-62443738 CAGGATAGAGAATTGGCAGGAGG + Intergenic
1110694487 13:78472282-78472304 CAGGACAGAGTCTCTTCTTGAGG - Intergenic
1113851857 13:113422424-113422446 CAGGACAGAGGGTCTGCAGCGGG + Intronic
1116760578 14:49008044-49008066 CAGAATATGGTGTCTGCAGGAGG - Intergenic
1119195531 14:72714482-72714504 CAGGCTCGCGGCTCTGCAGGGGG - Exonic
1121690484 14:95874899-95874921 CAGGACAGAGTCCCTCCATGAGG - Intergenic
1126142651 15:45450631-45450653 CAGGACAAAGTCTCTTCTGGAGG + Intergenic
1127475461 15:59328303-59328325 CAGAAGAGAGATTCTGCAGGAGG + Intronic
1127686577 15:61351376-61351398 CAGGATAGTGTTTGAGCAGGGGG + Intergenic
1127846001 15:62871521-62871543 CAGGATTGTGTTTCTTCAGGAGG - Intergenic
1128564850 15:68694211-68694233 CAGGGAAGACTTTCTGCAGGAGG + Intronic
1131066948 15:89440712-89440734 CAGGATTGAGTCACTGCACCCGG - Intergenic
1131228714 15:90645584-90645606 CAGGACAGAGTATCTGGTGGAGG - Intergenic
1132732030 16:1367393-1367415 CAGGCAAGAGGGTCTGCAGGTGG - Intronic
1133295341 16:4749155-4749177 CAGGGGAGGGTCTCTGTAGGTGG - Exonic
1136710842 16:32235122-32235144 CAGGAAGGGGTCTCTGCTGGTGG - Intergenic
1136757068 16:32694289-32694311 CAGGAAGGGGTCTCTGCTGGTGG + Intergenic
1136811041 16:33176086-33176108 CAGGAAGGGGTCTCTGCTGGTGG - Intergenic
1136817517 16:33286166-33286188 CAGGAAGGGGTCTCTGCTGGTGG - Intronic
1136824081 16:33342695-33342717 CAGGAAGGGGTCTCTGCTGGTGG - Intergenic
1140022383 16:71250871-71250893 CAGGATACTGGCTCTGCAAGGGG - Intergenic
1141887641 16:86903615-86903637 TAAGTTAGGGTCTCTGCAGGTGG + Intergenic
1141943117 16:87291535-87291557 CCTGAGAGAATCTCTGCAGGAGG - Intronic
1142112117 16:88338505-88338527 CAGGAGACAGTCTCTACAGACGG - Intergenic
1142175114 16:88641635-88641657 CAGGACAGAGGCTCTGGGGGAGG + Intergenic
1203059217 16_KI270728v1_random:954640-954662 CAGGAAGGGGTCTCTGCTGGTGG + Intergenic
1143764752 17:9130212-9130234 CAGGGCAGATTCTTTGCAGGAGG + Intronic
1145134487 17:20389320-20389342 CAGGATAAAGTCACTGTAAGTGG - Intergenic
1147182278 17:38693902-38693924 CAGGATAGAGTCTCCACATGAGG + Intergenic
1149297970 17:55277829-55277851 CAGAATCGAGTGTCTGCTGGGGG + Intronic
1150216784 17:63475820-63475842 CAGCATGGAGTGTGTGCAGGAGG - Intergenic
1152271575 17:79328055-79328077 CAGGAAAGGTTTTCTGCAGGAGG + Intronic
1152389943 17:79997826-79997848 CAGAATAGTGTCACTGCAGCCGG + Intronic
1152666068 17:81570389-81570411 CAGGCTTTTGTCTCTGCAGGAGG - Intronic
1153352140 18:4092738-4092760 CAGGACAGAGCCTCTCTAGGTGG - Intronic
1154277376 18:12974083-12974105 GGGGAAAGAGTGTCTGCAGGTGG + Intronic
1159453297 18:68629825-68629847 CAGGATAGAGCCACTGCACCTGG - Intergenic
1161642041 19:5430330-5430352 CAGGATAGAGTAAGTCCAGGAGG + Intergenic
1166800781 19:45455851-45455873 CAGCCCAGAGTGTCTGCAGGAGG + Intronic
1168457094 19:56521026-56521048 CAGGAGAGAGCTTGTGCAGGGGG + Intronic
927504140 2:23602380-23602402 CAGGACAGAATGTCTCCAGGAGG - Intronic
927945560 2:27133224-27133246 CAGGGTAGAGAATTTGCAGGCGG - Exonic
929457053 2:42073449-42073471 CAGAATGGAGTCTATGGAGGGGG - Intergenic
932216604 2:69970164-69970186 CAGGAGAGAGACTCAGGAGGAGG - Intergenic
934987759 2:98900013-98900035 GAGGACAGAGGCTCAGCAGGAGG + Intronic
937224701 2:120361699-120361721 CAGGAGAGAGTCCCAGGAGGAGG - Intergenic
937280301 2:120713114-120713136 GAGGCTGGCGTCTCTGCAGGAGG + Intergenic
937370410 2:121293665-121293687 CAGGTGCCAGTCTCTGCAGGGGG + Intergenic
939602111 2:144205169-144205191 TAGTATATAGTCTTTGCAGGTGG + Intronic
941697904 2:168573030-168573052 CAGGAAAGGGTTTCTGGAGGAGG + Intronic
941848988 2:170159995-170160017 CAGCATAGGGGCTCTCCAGGAGG - Intergenic
944194370 2:197036844-197036866 CAGGATAGAGTCTCTGAAGTAGG - Intronic
944398891 2:199302774-199302796 CAAGATACAGTCTGTGCAGCTGG + Intronic
945274943 2:207978739-207978761 CAGGACAGACTCTCTGAAAGAGG - Intronic
947488574 2:230574679-230574701 CAGGAGAGAGTGTGTGAAGGGGG + Intergenic
948830148 2:240594687-240594709 CTGTGTAGAGGCTCTGCAGGTGG - Exonic
1168947006 20:1769358-1769380 GTGGATAGAATCTCTGCACGAGG + Intergenic
1172046845 20:32086523-32086545 CAGGAAAGACTTTCTGGAGGAGG + Intronic
1173553522 20:43949560-43949582 CAGGACAGTGATTCTGCAGGAGG - Intronic
1174218973 20:48937134-48937156 CAGGACAGAGCCCGTGCAGGTGG - Intronic
1178934425 21:36849577-36849599 CAGCCTAGAGTTTCTGCTGGGGG + Intronic
1179959152 21:44758590-44758612 CAGGTGAGTGTCTCTGCAGGGGG - Intergenic
1180223528 21:46375555-46375577 CAGGCTAGAGCCTCTGCCAGGGG + Intronic
1183623382 22:38987407-38987429 CAGGGAAGAGTCTCAGCAGGGGG - Intronic
1183627687 22:39014603-39014625 CGGGGGAGAGTCTCAGCAGGCGG - Intronic
1183628981 22:39021759-39021781 CAGGGAAGAGTCTCAGGAGGGGG - Intronic
1183630191 22:39027864-39027886 CAGGGGAGAATCTCAGCAGGGGG - Intronic
1183633622 22:39047733-39047755 CGGGGGAGAGTCTCAGCAGGGGG - Intronic
1185390507 22:50558625-50558647 CAGGACGGAGTCCCTGCACGTGG - Intronic
952190269 3:31015540-31015562 CTGGATATAGCCTCTGCAGCAGG - Intergenic
952289640 3:32002988-32003010 CAGGGAAGACTGTCTGCAGGAGG + Intronic
952927143 3:38328643-38328665 CAGGGAAGACTCCCTGCAGGAGG - Intergenic
954309005 3:49750159-49750181 CAGGTCAGGGTCTCTGGAGGTGG + Intronic
954709586 3:52498765-52498787 CAGGGTAGAGGCTTGGCAGGAGG - Intronic
960953431 3:123014251-123014273 TCGTTTAGAGTCTCTGCAGGAGG - Intronic
962601023 3:136990902-136990924 CAGGGCAGAGCCTGTGCAGGAGG + Intronic
962726711 3:138235765-138235787 CAGAATGGAGTCACTGCAAGAGG - Intronic
967000416 3:185328525-185328547 CAGGCGAGAGCCACTGCAGGTGG + Intronic
967228721 3:187317841-187317863 CTGTATGGAGTCTCTGGAGGTGG + Intergenic
970561854 4:17289562-17289584 ATAGATAGAGTCACTGCAGGTGG - Intergenic
973656738 4:53055844-53055866 CAGGAGAGAGTCTGAGCAAGTGG - Intronic
974283848 4:59837982-59838004 GAGGATTGAAGCTCTGCAGGAGG + Intergenic
974358723 4:60847138-60847160 CAGAATAGAATCTGTGCATGTGG + Intergenic
975696177 4:77015549-77015571 CAGGATGGAGACTCACCAGGAGG - Intronic
982343130 4:154325613-154325635 GGGGAAAGAGTCTCTGAAGGAGG + Intronic
982854728 4:160365713-160365735 CTTCATAGACTCTCTGCAGGGGG + Intergenic
985625109 5:981805-981827 CAGGCTGGGGTCTCTGCTGGGGG - Intergenic
985830783 5:2227773-2227795 CAGGACAGAGACGCTGGAGGTGG + Intergenic
987749619 5:22022342-22022364 CAGGAGAGAGTGTGTGAAGGAGG - Intronic
989626773 5:43437208-43437230 CAGGTTAGAGTCTTTGGAGATGG - Intergenic
990798651 5:59573718-59573740 CAGGAGTGAGTCACTGCAGCTGG - Intronic
992761255 5:79952557-79952579 CAGGAAAGACTCTCTAAAGGAGG - Intergenic
992907082 5:81357164-81357186 CACGAGAGACTCGCTGCAGGAGG - Intronic
992953844 5:81887987-81888009 CAGGACATAGCCTGTGCAGGTGG - Intergenic
993660035 5:90622114-90622136 CAGGACAGGATCTCTGCAGGAGG - Intronic
996881932 5:128308136-128308158 AAGGATACATACTCTGCAGGAGG + Intronic
998378133 5:141704841-141704863 CAGGGTAGAGTCTATGGAAGTGG - Intergenic
999299362 5:150481678-150481700 GAGGATGGAGTCTAGGCAGGGGG + Intergenic
1000148826 5:158480172-158480194 CGGGAAAGAGTCTGTTCAGGTGG - Intergenic
1003522353 6:6868875-6868897 CAGGATAGAAGCCCCGCAGGCGG + Intergenic
1003769478 6:9282384-9282406 GATGGTAGAGTCTCTGAAGGGGG + Intergenic
1005001376 6:21245095-21245117 CAGGAAAGATTGTCTGCAGAAGG - Intergenic
1005750259 6:28875621-28875643 CAGGAAAGGGCATCTGCAGGGGG - Intergenic
1006620419 6:35360084-35360106 CTGGAATGAGACTCTGCAGGAGG - Intronic
1007279205 6:40698096-40698118 TATGATATACTCTCTGCAGGAGG + Intergenic
1008062973 6:47017984-47018006 CAGGATTGGGTCTCTGCAAGTGG + Intronic
1008274465 6:49526821-49526843 CAGCATGGAGACTCTTCAGGAGG - Exonic
1008895781 6:56553152-56553174 CAAGTTAAAGTCTCTGCAGAAGG - Exonic
1013327049 6:109056784-109056806 CAGGATGTAGTCCCTTCAGGAGG - Intronic
1015679544 6:135789997-135790019 CAAAATAGAGTCTGTGCATGTGG - Intergenic
1015864131 6:137710831-137710853 CAGCATGGAGTCTCAGCAGGTGG - Intergenic
1021790385 7:24198729-24198751 AAGAAATGAGTCTCTGCAGGAGG - Intergenic
1021853759 7:24833625-24833647 CAGGAGAGAGACTCTGCATCTGG + Intronic
1022033662 7:26514790-26514812 CAGGAAAGAGTGTGTGCGGGGGG + Intergenic
1028493809 7:91442121-91442143 CAGGATGGAGTCAGTGCAAGTGG - Intergenic
1029186285 7:98741185-98741207 CCGGATGGATGCTCTGCAGGTGG - Intergenic
1029188345 7:98755073-98755095 GAGGATGGAGTTCCTGCAGGAGG + Intergenic
1029416952 7:100449221-100449243 AGGGATAGAGTGGCTGCAGGTGG + Intergenic
1032762265 7:134954726-134954748 GAGGATAGAGGCACTGCAGAAGG - Intronic
1033307037 7:140232293-140232315 CAGGAAACAGTATCTGCAGGTGG - Intergenic
1033425434 7:141239560-141239582 CAGCCTCGAGTCTCAGCAGGGGG + Intronic
1033647035 7:143313087-143313109 CAGGGTAGAGGCTCAGAAGGAGG + Intergenic
1036218749 8:6902775-6902797 CAGGACAGAGCCCCTGCAAGTGG - Intergenic
1038504835 8:28075299-28075321 CAGCATGGAGCATCTGCAGGAGG + Intronic
1039431219 8:37526567-37526589 CAGGATGAAGGCTCTGCAGCAGG + Intergenic
1039806712 8:41006151-41006173 CATGACAGAGTCTCAGAAGGGGG + Intergenic
1040441242 8:47445065-47445087 CATAGTAGAGTCTCTGCAGCTGG + Intronic
1041389396 8:57335627-57335649 CAGGAGGGTGTCTCTGGAGGAGG + Intergenic
1041724373 8:61004591-61004613 CAGGATGGAGGCTCTGCAGAAGG + Intergenic
1048037973 8:130695452-130695474 CAGGATAGAGAATTTGCAGATGG + Intergenic
1048374663 8:133812727-133812749 CAGGATTGAGTCTCCCAAGGTGG - Intergenic
1049216001 8:141408696-141408718 CAGGACAGAGTCTGTGTAGGCGG - Intronic
1049352572 8:142171970-142171992 GAGGGTGGAGGCTCTGCAGGGGG + Intergenic
1049370214 8:142260843-142260865 CAGGGCAGAGCCTCTGCAGCTGG + Intronic
1049446792 8:142634970-142634992 CAGGATAGCCTCTCAGCTGGAGG - Intergenic
1054754864 9:68947346-68947368 CAGGGCAGTGTCTCTGGAGGTGG - Intronic
1055785423 9:79864901-79864923 GAGTATGAAGTCTCTGCAGGTGG - Intergenic
1055828935 9:80358307-80358329 GAGTATGAAGTCTCTGCAGGTGG + Intergenic
1056499743 9:87197204-87197226 CAGGAGAGAGTGTTTGCTGGTGG + Intergenic
1056544182 9:87600306-87600328 CAGGCATGAGTCACTGCAGGAGG - Intronic
1056859930 9:90171567-90171589 CAGGATTGAATCTGTGCAGTAGG - Intergenic
1058701582 9:107605209-107605231 CAGGACAGTGCCTTTGCAGGTGG + Intergenic
1059539795 9:115118684-115118706 CAGGATTAGGTCTCAGCAGGTGG + Intergenic
1060110319 9:120902182-120902204 CAGGATGAAGTCTCCGCAGGGGG - Intergenic
1060110960 9:120905896-120905918 CAGGATGAAGTCTCCGCAGGGGG - Intronic
1185483930 X:468183-468205 CAGGCTGGAGGCTCTGAAGGAGG - Intergenic
1188505841 X:30883903-30883925 AAGGCTAGAGTCTGTGCAGGGGG - Intronic
1189325657 X:40109352-40109374 CAGGACAGAAACTCTGCAAGCGG + Intronic
1192827096 X:74708793-74708815 CAGGCTTGAGTCTCTGCACCCGG + Intergenic
1194019207 X:88666241-88666263 CAGACAAGAGTTTCTGCAGGTGG + Intergenic
1198076309 X:133196516-133196538 CACGATAGAGTGACTGCAGGTGG + Intergenic
1199894773 X:152118719-152118741 CAGGATAGGGTTTCTGGTGGGGG + Intergenic
1200684447 Y:6246388-6246410 CAGGATGGAGGCTGTGCAGGAGG + Exonic
1200687089 Y:6266712-6266734 CAGGATGGAGGCTGTACAGGAGG + Intergenic
1200690679 Y:6304933-6304955 CAGGATGGAGGCTGTACAGGAGG - Intergenic
1200831091 Y:7689407-7689429 CAGGATGGAGGCTCTACAGGAGG - Intergenic
1200989970 Y:9337629-9337651 CAGGATGGAGGCTGTACAGGAGG + Exonic
1200992638 Y:9357962-9357984 CAGGATGGAGGCTGTACAGGAGG + Exonic
1200995292 Y:9378241-9378263 CAGGATGGAGGCTGTGCAGGAGG + Intronic
1200997956 Y:9398586-9398608 CAGGATGGAGGCTGTACAGGAGG + Exonic
1201000465 Y:9467120-9467142 CAGGATGGAGGCTGTGCAGGAGG + Exonic
1201003127 Y:9487432-9487454 CAGGATGGAGGCTGTACAGGAGG + Exonic
1201005786 Y:9507715-9507737 CAGGATGGAGGCTGTACAGGAGG + Intergenic
1201008446 Y:9528045-9528067 CAGGATGGAGGCTGTACAGGAGG + Exonic
1201011032 Y:9548223-9548245 CAGGATGGAGGCTGTACAGGAGG + Intergenic
1201038089 Y:9803148-9803170 CAGGCTATAGTCTCTCCATGAGG + Intergenic
1201044593 Y:9869783-9869805 CAGGATGGAGGCTGTACAGGAGG + Intergenic
1201048185 Y:9907998-9908020 CAGGATGGAGGCTGTACAGGAGG - Intergenic
1201063521 Y:10069010-10069032 CAGGATAGAGTCTCTGCAGGAGG - Intergenic
1202115840 Y:21468274-21468296 CAGGATGGAGGCTCTACAGGAGG + Intergenic