ID: 1201066956

View in Genome Browser
Species Human (GRCh38)
Location Y:10106194-10106216
Sequence CTGCTGCTAGGTGGGAGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201066956_1201066967 18 Left 1201066956 Y:10106194-10106216 CCTCCACTCCCACCTAGCAGCAG No data
Right 1201066967 Y:10106235-10106257 CCAGTGAATTTGGGAGAGGGAGG No data
1201066956_1201066968 19 Left 1201066956 Y:10106194-10106216 CCTCCACTCCCACCTAGCAGCAG No data
Right 1201066968 Y:10106236-10106258 CAGTGAATTTGGGAGAGGGAGGG No data
1201066956_1201066964 14 Left 1201066956 Y:10106194-10106216 CCTCCACTCCCACCTAGCAGCAG No data
Right 1201066964 Y:10106231-10106253 GAAACCAGTGAATTTGGGAGAGG No data
1201066956_1201066963 9 Left 1201066956 Y:10106194-10106216 CCTCCACTCCCACCTAGCAGCAG No data
Right 1201066963 Y:10106226-10106248 ACAGAGAAACCAGTGAATTTGGG No data
1201066956_1201066965 15 Left 1201066956 Y:10106194-10106216 CCTCCACTCCCACCTAGCAGCAG No data
Right 1201066965 Y:10106232-10106254 AAACCAGTGAATTTGGGAGAGGG No data
1201066956_1201066962 8 Left 1201066956 Y:10106194-10106216 CCTCCACTCCCACCTAGCAGCAG No data
Right 1201066962 Y:10106225-10106247 CACAGAGAAACCAGTGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201066956 Original CRISPR CTGCTGCTAGGTGGGAGTGG AGG (reversed) Intergenic
No off target data available for this crispr