ID: 1201066957

View in Genome Browser
Species Human (GRCh38)
Location Y:10106197-10106219
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201066957_1201066962 5 Left 1201066957 Y:10106197-10106219 CCACTCCCACCTAGCAGCAGCCA No data
Right 1201066962 Y:10106225-10106247 CACAGAGAAACCAGTGAATTTGG No data
1201066957_1201066963 6 Left 1201066957 Y:10106197-10106219 CCACTCCCACCTAGCAGCAGCCA No data
Right 1201066963 Y:10106226-10106248 ACAGAGAAACCAGTGAATTTGGG No data
1201066957_1201066964 11 Left 1201066957 Y:10106197-10106219 CCACTCCCACCTAGCAGCAGCCA No data
Right 1201066964 Y:10106231-10106253 GAAACCAGTGAATTTGGGAGAGG No data
1201066957_1201066969 28 Left 1201066957 Y:10106197-10106219 CCACTCCCACCTAGCAGCAGCCA No data
Right 1201066969 Y:10106248-10106270 GAGAGGGAGGGCACAGTGACTGG No data
1201066957_1201066968 16 Left 1201066957 Y:10106197-10106219 CCACTCCCACCTAGCAGCAGCCA No data
Right 1201066968 Y:10106236-10106258 CAGTGAATTTGGGAGAGGGAGGG No data
1201066957_1201066967 15 Left 1201066957 Y:10106197-10106219 CCACTCCCACCTAGCAGCAGCCA No data
Right 1201066967 Y:10106235-10106257 CCAGTGAATTTGGGAGAGGGAGG No data
1201066957_1201066965 12 Left 1201066957 Y:10106197-10106219 CCACTCCCACCTAGCAGCAGCCA No data
Right 1201066965 Y:10106232-10106254 AAACCAGTGAATTTGGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201066957 Original CRISPR TGGCTGCTGCTAGGTGGGAG TGG (reversed) Intergenic
No off target data available for this crispr