ID: 1201066958

View in Genome Browser
Species Human (GRCh38)
Location Y:10106202-10106224
Sequence TTGTGTGGCTGCTGCTAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201066958_1201066968 11 Left 1201066958 Y:10106202-10106224 CCCACCTAGCAGCAGCCACACAA No data
Right 1201066968 Y:10106236-10106258 CAGTGAATTTGGGAGAGGGAGGG No data
1201066958_1201066969 23 Left 1201066958 Y:10106202-10106224 CCCACCTAGCAGCAGCCACACAA No data
Right 1201066969 Y:10106248-10106270 GAGAGGGAGGGCACAGTGACTGG No data
1201066958_1201066962 0 Left 1201066958 Y:10106202-10106224 CCCACCTAGCAGCAGCCACACAA No data
Right 1201066962 Y:10106225-10106247 CACAGAGAAACCAGTGAATTTGG No data
1201066958_1201066964 6 Left 1201066958 Y:10106202-10106224 CCCACCTAGCAGCAGCCACACAA No data
Right 1201066964 Y:10106231-10106253 GAAACCAGTGAATTTGGGAGAGG No data
1201066958_1201066970 26 Left 1201066958 Y:10106202-10106224 CCCACCTAGCAGCAGCCACACAA No data
Right 1201066970 Y:10106251-10106273 AGGGAGGGCACAGTGACTGGAGG No data
1201066958_1201066967 10 Left 1201066958 Y:10106202-10106224 CCCACCTAGCAGCAGCCACACAA No data
Right 1201066967 Y:10106235-10106257 CCAGTGAATTTGGGAGAGGGAGG No data
1201066958_1201066963 1 Left 1201066958 Y:10106202-10106224 CCCACCTAGCAGCAGCCACACAA No data
Right 1201066963 Y:10106226-10106248 ACAGAGAAACCAGTGAATTTGGG No data
1201066958_1201066965 7 Left 1201066958 Y:10106202-10106224 CCCACCTAGCAGCAGCCACACAA No data
Right 1201066965 Y:10106232-10106254 AAACCAGTGAATTTGGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201066958 Original CRISPR TTGTGTGGCTGCTGCTAGGT GGG (reversed) Intergenic