ID: 1201066959

View in Genome Browser
Species Human (GRCh38)
Location Y:10106203-10106225
Sequence GTTGTGTGGCTGCTGCTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201066959_1201066969 22 Left 1201066959 Y:10106203-10106225 CCACCTAGCAGCAGCCACACAAC No data
Right 1201066969 Y:10106248-10106270 GAGAGGGAGGGCACAGTGACTGG No data
1201066959_1201066963 0 Left 1201066959 Y:10106203-10106225 CCACCTAGCAGCAGCCACACAAC No data
Right 1201066963 Y:10106226-10106248 ACAGAGAAACCAGTGAATTTGGG No data
1201066959_1201066967 9 Left 1201066959 Y:10106203-10106225 CCACCTAGCAGCAGCCACACAAC No data
Right 1201066967 Y:10106235-10106257 CCAGTGAATTTGGGAGAGGGAGG No data
1201066959_1201066970 25 Left 1201066959 Y:10106203-10106225 CCACCTAGCAGCAGCCACACAAC No data
Right 1201066970 Y:10106251-10106273 AGGGAGGGCACAGTGACTGGAGG No data
1201066959_1201066968 10 Left 1201066959 Y:10106203-10106225 CCACCTAGCAGCAGCCACACAAC No data
Right 1201066968 Y:10106236-10106258 CAGTGAATTTGGGAGAGGGAGGG No data
1201066959_1201066965 6 Left 1201066959 Y:10106203-10106225 CCACCTAGCAGCAGCCACACAAC No data
Right 1201066965 Y:10106232-10106254 AAACCAGTGAATTTGGGAGAGGG No data
1201066959_1201066964 5 Left 1201066959 Y:10106203-10106225 CCACCTAGCAGCAGCCACACAAC No data
Right 1201066964 Y:10106231-10106253 GAAACCAGTGAATTTGGGAGAGG No data
1201066959_1201066962 -1 Left 1201066959 Y:10106203-10106225 CCACCTAGCAGCAGCCACACAAC No data
Right 1201066962 Y:10106225-10106247 CACAGAGAAACCAGTGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201066959 Original CRISPR GTTGTGTGGCTGCTGCTAGG TGG (reversed) Intergenic
No off target data available for this crispr