ID: 1201066961

View in Genome Browser
Species Human (GRCh38)
Location Y:10106217-10106239
Sequence ACTGGTTTCTCTGTGTTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201066961_1201066968 -4 Left 1201066961 Y:10106217-10106239 CCACACAACACAGAGAAACCAGT No data
Right 1201066968 Y:10106236-10106258 CAGTGAATTTGGGAGAGGGAGGG No data
1201066961_1201066967 -5 Left 1201066961 Y:10106217-10106239 CCACACAACACAGAGAAACCAGT No data
Right 1201066967 Y:10106235-10106257 CCAGTGAATTTGGGAGAGGGAGG No data
1201066961_1201066965 -8 Left 1201066961 Y:10106217-10106239 CCACACAACACAGAGAAACCAGT No data
Right 1201066965 Y:10106232-10106254 AAACCAGTGAATTTGGGAGAGGG No data
1201066961_1201066970 11 Left 1201066961 Y:10106217-10106239 CCACACAACACAGAGAAACCAGT No data
Right 1201066970 Y:10106251-10106273 AGGGAGGGCACAGTGACTGGAGG No data
1201066961_1201066964 -9 Left 1201066961 Y:10106217-10106239 CCACACAACACAGAGAAACCAGT No data
Right 1201066964 Y:10106231-10106253 GAAACCAGTGAATTTGGGAGAGG No data
1201066961_1201066969 8 Left 1201066961 Y:10106217-10106239 CCACACAACACAGAGAAACCAGT No data
Right 1201066969 Y:10106248-10106270 GAGAGGGAGGGCACAGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201066961 Original CRISPR ACTGGTTTCTCTGTGTTGTG TGG (reversed) Intergenic