ID: 1201066963

View in Genome Browser
Species Human (GRCh38)
Location Y:10106226-10106248
Sequence ACAGAGAAACCAGTGAATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201066956_1201066963 9 Left 1201066956 Y:10106194-10106216 CCTCCACTCCCACCTAGCAGCAG No data
Right 1201066963 Y:10106226-10106248 ACAGAGAAACCAGTGAATTTGGG No data
1201066959_1201066963 0 Left 1201066959 Y:10106203-10106225 CCACCTAGCAGCAGCCACACAAC No data
Right 1201066963 Y:10106226-10106248 ACAGAGAAACCAGTGAATTTGGG No data
1201066957_1201066963 6 Left 1201066957 Y:10106197-10106219 CCACTCCCACCTAGCAGCAGCCA No data
Right 1201066963 Y:10106226-10106248 ACAGAGAAACCAGTGAATTTGGG No data
1201066955_1201066963 14 Left 1201066955 Y:10106189-10106211 CCAATCCTCCACTCCCACCTAGC No data
Right 1201066963 Y:10106226-10106248 ACAGAGAAACCAGTGAATTTGGG No data
1201066958_1201066963 1 Left 1201066958 Y:10106202-10106224 CCCACCTAGCAGCAGCCACACAA No data
Right 1201066963 Y:10106226-10106248 ACAGAGAAACCAGTGAATTTGGG No data
1201066960_1201066963 -3 Left 1201066960 Y:10106206-10106228 CCTAGCAGCAGCCACACAACACA No data
Right 1201066963 Y:10106226-10106248 ACAGAGAAACCAGTGAATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201066963 Original CRISPR ACAGAGAAACCAGTGAATTT GGG Intergenic
No off target data available for this crispr