ID: 1201066964

View in Genome Browser
Species Human (GRCh38)
Location Y:10106231-10106253
Sequence GAAACCAGTGAATTTGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201066959_1201066964 5 Left 1201066959 Y:10106203-10106225 CCACCTAGCAGCAGCCACACAAC No data
Right 1201066964 Y:10106231-10106253 GAAACCAGTGAATTTGGGAGAGG No data
1201066960_1201066964 2 Left 1201066960 Y:10106206-10106228 CCTAGCAGCAGCCACACAACACA No data
Right 1201066964 Y:10106231-10106253 GAAACCAGTGAATTTGGGAGAGG No data
1201066955_1201066964 19 Left 1201066955 Y:10106189-10106211 CCAATCCTCCACTCCCACCTAGC No data
Right 1201066964 Y:10106231-10106253 GAAACCAGTGAATTTGGGAGAGG No data
1201066957_1201066964 11 Left 1201066957 Y:10106197-10106219 CCACTCCCACCTAGCAGCAGCCA No data
Right 1201066964 Y:10106231-10106253 GAAACCAGTGAATTTGGGAGAGG No data
1201066958_1201066964 6 Left 1201066958 Y:10106202-10106224 CCCACCTAGCAGCAGCCACACAA No data
Right 1201066964 Y:10106231-10106253 GAAACCAGTGAATTTGGGAGAGG No data
1201066961_1201066964 -9 Left 1201066961 Y:10106217-10106239 CCACACAACACAGAGAAACCAGT No data
Right 1201066964 Y:10106231-10106253 GAAACCAGTGAATTTGGGAGAGG No data
1201066956_1201066964 14 Left 1201066956 Y:10106194-10106216 CCTCCACTCCCACCTAGCAGCAG No data
Right 1201066964 Y:10106231-10106253 GAAACCAGTGAATTTGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201066964 Original CRISPR GAAACCAGTGAATTTGGGAG AGG Intergenic
No off target data available for this crispr