ID: 1201066966

View in Genome Browser
Species Human (GRCh38)
Location Y:10106235-10106257
Sequence CCTCCCTCTCCCAAATTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201066966_1201066970 -7 Left 1201066966 Y:10106235-10106257 CCAGTGAATTTGGGAGAGGGAGG No data
Right 1201066970 Y:10106251-10106273 AGGGAGGGCACAGTGACTGGAGG No data
1201066966_1201066969 -10 Left 1201066966 Y:10106235-10106257 CCAGTGAATTTGGGAGAGGGAGG No data
Right 1201066969 Y:10106248-10106270 GAGAGGGAGGGCACAGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201066966 Original CRISPR CCTCCCTCTCCCAAATTCAC TGG (reversed) Intergenic
No off target data available for this crispr