ID: 1201066966 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | Y:10106235-10106257 |
| Sequence | CCTCCCTCTCCCAAATTCAC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1201066966_1201066970 | -7 | Left | 1201066966 | Y:10106235-10106257 | CCAGTGAATTTGGGAGAGGGAGG | No data | ||
| Right | 1201066970 | Y:10106251-10106273 | AGGGAGGGCACAGTGACTGGAGG | No data | ||||
| 1201066966_1201066969 | -10 | Left | 1201066966 | Y:10106235-10106257 | CCAGTGAATTTGGGAGAGGGAGG | No data | ||
| Right | 1201066969 | Y:10106248-10106270 | GAGAGGGAGGGCACAGTGACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1201066966 | Original CRISPR | CCTCCCTCTCCCAAATTCAC TGG (reversed) | Intergenic | ||