ID: 1201066968

View in Genome Browser
Species Human (GRCh38)
Location Y:10106236-10106258
Sequence CAGTGAATTTGGGAGAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201066959_1201066968 10 Left 1201066959 Y:10106203-10106225 CCACCTAGCAGCAGCCACACAAC No data
Right 1201066968 Y:10106236-10106258 CAGTGAATTTGGGAGAGGGAGGG No data
1201066958_1201066968 11 Left 1201066958 Y:10106202-10106224 CCCACCTAGCAGCAGCCACACAA No data
Right 1201066968 Y:10106236-10106258 CAGTGAATTTGGGAGAGGGAGGG No data
1201066957_1201066968 16 Left 1201066957 Y:10106197-10106219 CCACTCCCACCTAGCAGCAGCCA No data
Right 1201066968 Y:10106236-10106258 CAGTGAATTTGGGAGAGGGAGGG No data
1201066961_1201066968 -4 Left 1201066961 Y:10106217-10106239 CCACACAACACAGAGAAACCAGT No data
Right 1201066968 Y:10106236-10106258 CAGTGAATTTGGGAGAGGGAGGG No data
1201066956_1201066968 19 Left 1201066956 Y:10106194-10106216 CCTCCACTCCCACCTAGCAGCAG No data
Right 1201066968 Y:10106236-10106258 CAGTGAATTTGGGAGAGGGAGGG No data
1201066955_1201066968 24 Left 1201066955 Y:10106189-10106211 CCAATCCTCCACTCCCACCTAGC No data
Right 1201066968 Y:10106236-10106258 CAGTGAATTTGGGAGAGGGAGGG No data
1201066960_1201066968 7 Left 1201066960 Y:10106206-10106228 CCTAGCAGCAGCCACACAACACA No data
Right 1201066968 Y:10106236-10106258 CAGTGAATTTGGGAGAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201066968 Original CRISPR CAGTGAATTTGGGAGAGGGA GGG Intergenic
No off target data available for this crispr