ID: 1201066970

View in Genome Browser
Species Human (GRCh38)
Location Y:10106251-10106273
Sequence AGGGAGGGCACAGTGACTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201066961_1201066970 11 Left 1201066961 Y:10106217-10106239 CCACACAACACAGAGAAACCAGT No data
Right 1201066970 Y:10106251-10106273 AGGGAGGGCACAGTGACTGGAGG No data
1201066966_1201066970 -7 Left 1201066966 Y:10106235-10106257 CCAGTGAATTTGGGAGAGGGAGG No data
Right 1201066970 Y:10106251-10106273 AGGGAGGGCACAGTGACTGGAGG No data
1201066960_1201066970 22 Left 1201066960 Y:10106206-10106228 CCTAGCAGCAGCCACACAACACA No data
Right 1201066970 Y:10106251-10106273 AGGGAGGGCACAGTGACTGGAGG No data
1201066958_1201066970 26 Left 1201066958 Y:10106202-10106224 CCCACCTAGCAGCAGCCACACAA No data
Right 1201066970 Y:10106251-10106273 AGGGAGGGCACAGTGACTGGAGG No data
1201066959_1201066970 25 Left 1201066959 Y:10106203-10106225 CCACCTAGCAGCAGCCACACAAC No data
Right 1201066970 Y:10106251-10106273 AGGGAGGGCACAGTGACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201066970 Original CRISPR AGGGAGGGCACAGTGACTGG AGG Intergenic
No off target data available for this crispr