ID: 1201073771

View in Genome Browser
Species Human (GRCh38)
Location Y:10171658-10171680
Sequence ACTGGGGGAGTTGAAGGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201073771_1201073782 23 Left 1201073771 Y:10171658-10171680 CCAAGTCCTTCAACTCCCCCAGT No data
Right 1201073782 Y:10171704-10171726 TGCCTTTTGCTGAAATTCTGGGG No data
1201073771_1201073780 21 Left 1201073771 Y:10171658-10171680 CCAAGTCCTTCAACTCCCCCAGT No data
Right 1201073780 Y:10171702-10171724 TGTGCCTTTTGCTGAAATTCTGG No data
1201073771_1201073774 -8 Left 1201073771 Y:10171658-10171680 CCAAGTCCTTCAACTCCCCCAGT No data
Right 1201073774 Y:10171673-10171695 CCCCCAGTAGCTCCGTTGCTAGG No data
1201073771_1201073781 22 Left 1201073771 Y:10171658-10171680 CCAAGTCCTTCAACTCCCCCAGT No data
Right 1201073781 Y:10171703-10171725 GTGCCTTTTGCTGAAATTCTGGG No data
1201073771_1201073778 -3 Left 1201073771 Y:10171658-10171680 CCAAGTCCTTCAACTCCCCCAGT No data
Right 1201073778 Y:10171678-10171700 AGTAGCTCCGTTGCTAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201073771 Original CRISPR ACTGGGGGAGTTGAAGGACT TGG (reversed) Intergenic
No off target data available for this crispr