ID: 1201073776

View in Genome Browser
Species Human (GRCh38)
Location Y:10171675-10171697
Sequence TTCCTAGCAACGGAGCTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201073776_1201073780 4 Left 1201073776 Y:10171675-10171697 CCCAGTAGCTCCGTTGCTAGGAA No data
Right 1201073780 Y:10171702-10171724 TGTGCCTTTTGCTGAAATTCTGG No data
1201073776_1201073781 5 Left 1201073776 Y:10171675-10171697 CCCAGTAGCTCCGTTGCTAGGAA No data
Right 1201073781 Y:10171703-10171725 GTGCCTTTTGCTGAAATTCTGGG No data
1201073776_1201073784 29 Left 1201073776 Y:10171675-10171697 CCCAGTAGCTCCGTTGCTAGGAA No data
Right 1201073784 Y:10171727-10171749 TCGACAGAAGCTCATCTAACAGG No data
1201073776_1201073782 6 Left 1201073776 Y:10171675-10171697 CCCAGTAGCTCCGTTGCTAGGAA No data
Right 1201073782 Y:10171704-10171726 TGCCTTTTGCTGAAATTCTGGGG No data
1201073776_1201073785 30 Left 1201073776 Y:10171675-10171697 CCCAGTAGCTCCGTTGCTAGGAA No data
Right 1201073785 Y:10171728-10171750 CGACAGAAGCTCATCTAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201073776 Original CRISPR TTCCTAGCAACGGAGCTACT GGG (reversed) Intergenic
No off target data available for this crispr