ID: 1201073781

View in Genome Browser
Species Human (GRCh38)
Location Y:10171703-10171725
Sequence GTGCCTTTTGCTGAAATTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201073773_1201073781 7 Left 1201073773 Y:10171673-10171695 CCCCCAGTAGCTCCGTTGCTAGG No data
Right 1201073781 Y:10171703-10171725 GTGCCTTTTGCTGAAATTCTGGG No data
1201073775_1201073781 6 Left 1201073775 Y:10171674-10171696 CCCCAGTAGCTCCGTTGCTAGGA No data
Right 1201073781 Y:10171703-10171725 GTGCCTTTTGCTGAAATTCTGGG No data
1201073777_1201073781 4 Left 1201073777 Y:10171676-10171698 CCAGTAGCTCCGTTGCTAGGAAA No data
Right 1201073781 Y:10171703-10171725 GTGCCTTTTGCTGAAATTCTGGG No data
1201073779_1201073781 -5 Left 1201073779 Y:10171685-10171707 CCGTTGCTAGGAAAGGTTGTGCC No data
Right 1201073781 Y:10171703-10171725 GTGCCTTTTGCTGAAATTCTGGG No data
1201073771_1201073781 22 Left 1201073771 Y:10171658-10171680 CCAAGTCCTTCAACTCCCCCAGT No data
Right 1201073781 Y:10171703-10171725 GTGCCTTTTGCTGAAATTCTGGG No data
1201073772_1201073781 16 Left 1201073772 Y:10171664-10171686 CCTTCAACTCCCCCAGTAGCTCC No data
Right 1201073781 Y:10171703-10171725 GTGCCTTTTGCTGAAATTCTGGG No data
1201073776_1201073781 5 Left 1201073776 Y:10171675-10171697 CCCAGTAGCTCCGTTGCTAGGAA No data
Right 1201073781 Y:10171703-10171725 GTGCCTTTTGCTGAAATTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201073781 Original CRISPR GTGCCTTTTGCTGAAATTCT GGG Intergenic
No off target data available for this crispr