ID: 1201073783 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | Y:10171706-10171728 |
| Sequence | GACCCCAGAATTTCAGCAAA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1201073783_1201073784 | -2 | Left | 1201073783 | Y:10171706-10171728 | CCTTTTGCTGAAATTCTGGGGTC | No data | ||
| Right | 1201073784 | Y:10171727-10171749 | TCGACAGAAGCTCATCTAACAGG | No data | ||||
| 1201073783_1201073785 | -1 | Left | 1201073783 | Y:10171706-10171728 | CCTTTTGCTGAAATTCTGGGGTC | No data | ||
| Right | 1201073785 | Y:10171728-10171750 | CGACAGAAGCTCATCTAACAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1201073783 | Original CRISPR | GACCCCAGAATTTCAGCAAA AGG (reversed) | Intergenic | ||