ID: 1201073783

View in Genome Browser
Species Human (GRCh38)
Location Y:10171706-10171728
Sequence GACCCCAGAATTTCAGCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201073783_1201073785 -1 Left 1201073783 Y:10171706-10171728 CCTTTTGCTGAAATTCTGGGGTC No data
Right 1201073785 Y:10171728-10171750 CGACAGAAGCTCATCTAACAGGG No data
1201073783_1201073784 -2 Left 1201073783 Y:10171706-10171728 CCTTTTGCTGAAATTCTGGGGTC No data
Right 1201073784 Y:10171727-10171749 TCGACAGAAGCTCATCTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201073783 Original CRISPR GACCCCAGAATTTCAGCAAA AGG (reversed) Intergenic
No off target data available for this crispr