ID: 1201073785

View in Genome Browser
Species Human (GRCh38)
Location Y:10171728-10171750
Sequence CGACAGAAGCTCATCTAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201073783_1201073785 -1 Left 1201073783 Y:10171706-10171728 CCTTTTGCTGAAATTCTGGGGTC No data
Right 1201073785 Y:10171728-10171750 CGACAGAAGCTCATCTAACAGGG No data
1201073779_1201073785 20 Left 1201073779 Y:10171685-10171707 CCGTTGCTAGGAAAGGTTGTGCC No data
Right 1201073785 Y:10171728-10171750 CGACAGAAGCTCATCTAACAGGG No data
1201073777_1201073785 29 Left 1201073777 Y:10171676-10171698 CCAGTAGCTCCGTTGCTAGGAAA No data
Right 1201073785 Y:10171728-10171750 CGACAGAAGCTCATCTAACAGGG No data
1201073776_1201073785 30 Left 1201073776 Y:10171675-10171697 CCCAGTAGCTCCGTTGCTAGGAA No data
Right 1201073785 Y:10171728-10171750 CGACAGAAGCTCATCTAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201073785 Original CRISPR CGACAGAAGCTCATCTAACA GGG Intergenic
No off target data available for this crispr