ID: 1201076752

View in Genome Browser
Species Human (GRCh38)
Location Y:10195349-10195371
Sequence CTAAGGGAGCTCGTTGGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201076741_1201076752 12 Left 1201076741 Y:10195314-10195336 CCTCCAGTCACCGCCGCGGTGTC No data
Right 1201076752 Y:10195349-10195371 CTAAGGGAGCTCGTTGGTGTGGG No data
1201076744_1201076752 2 Left 1201076744 Y:10195324-10195346 CCGCCGCGGTGTCTGCAAATGGG No data
Right 1201076752 Y:10195349-10195371 CTAAGGGAGCTCGTTGGTGTGGG No data
1201076746_1201076752 -1 Left 1201076746 Y:10195327-10195349 CCGCGGTGTCTGCAAATGGGTCC No data
Right 1201076752 Y:10195349-10195371 CTAAGGGAGCTCGTTGGTGTGGG No data
1201076733_1201076752 26 Left 1201076733 Y:10195300-10195322 CCCCAGCGCCCCCTCCTCCAGTC No data
Right 1201076752 Y:10195349-10195371 CTAAGGGAGCTCGTTGGTGTGGG No data
1201076737_1201076752 17 Left 1201076737 Y:10195309-10195331 CCCCTCCTCCAGTCACCGCCGCG No data
Right 1201076752 Y:10195349-10195371 CTAAGGGAGCTCGTTGGTGTGGG No data
1201076731_1201076752 30 Left 1201076731 Y:10195296-10195318 CCACCCCCAGCGCCCCCTCCTCC 0: 5
1: 14
2: 26
3: 491
4: 4127
Right 1201076752 Y:10195349-10195371 CTAAGGGAGCTCGTTGGTGTGGG No data
1201076734_1201076752 25 Left 1201076734 Y:10195301-10195323 CCCAGCGCCCCCTCCTCCAGTCA No data
Right 1201076752 Y:10195349-10195371 CTAAGGGAGCTCGTTGGTGTGGG No data
1201076735_1201076752 24 Left 1201076735 Y:10195302-10195324 CCAGCGCCCCCTCCTCCAGTCAC No data
Right 1201076752 Y:10195349-10195371 CTAAGGGAGCTCGTTGGTGTGGG No data
1201076740_1201076752 15 Left 1201076740 Y:10195311-10195333 CCTCCTCCAGTCACCGCCGCGGT No data
Right 1201076752 Y:10195349-10195371 CTAAGGGAGCTCGTTGGTGTGGG No data
1201076738_1201076752 16 Left 1201076738 Y:10195310-10195332 CCCTCCTCCAGTCACCGCCGCGG No data
Right 1201076752 Y:10195349-10195371 CTAAGGGAGCTCGTTGGTGTGGG No data
1201076736_1201076752 18 Left 1201076736 Y:10195308-10195330 CCCCCTCCTCCAGTCACCGCCGC No data
Right 1201076752 Y:10195349-10195371 CTAAGGGAGCTCGTTGGTGTGGG No data
1201076742_1201076752 9 Left 1201076742 Y:10195317-10195339 CCAGTCACCGCCGCGGTGTCTGC No data
Right 1201076752 Y:10195349-10195371 CTAAGGGAGCTCGTTGGTGTGGG No data
1201076732_1201076752 27 Left 1201076732 Y:10195299-10195321 CCCCCAGCGCCCCCTCCTCCAGT No data
Right 1201076752 Y:10195349-10195371 CTAAGGGAGCTCGTTGGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201076752 Original CRISPR CTAAGGGAGCTCGTTGGTGT GGG Intergenic
No off target data available for this crispr