ID: 1201076823

View in Genome Browser
Species Human (GRCh38)
Location Y:10195632-10195654
Sequence GGGATTGCGCGCACGCGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201076810_1201076823 19 Left 1201076810 Y:10195590-10195612 CCTGGGAGAAAGGAGGCGGGTGG No data
Right 1201076823 Y:10195632-10195654 GGGATTGCGCGCACGCGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201076823 Original CRISPR GGGATTGCGCGCACGCGCAG TGG Intergenic
No off target data available for this crispr