ID: 1201143446

View in Genome Browser
Species Human (GRCh38)
Location Y:11047410-11047432
Sequence GAGCATAAGGAGAGGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201143439_1201143446 -9 Left 1201143439 Y:11047396-11047418 CCAAGTTGAGGGCCGAGCATAAG No data
Right 1201143446 Y:11047410-11047432 GAGCATAAGGAGAGGGAGGGAGG No data
1201143432_1201143446 30 Left 1201143432 Y:11047357-11047379 CCAGGAACACAGAGGGATATGTG No data
Right 1201143446 Y:11047410-11047432 GAGCATAAGGAGAGGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201143446 Original CRISPR GAGCATAAGGAGAGGGAGGG AGG Intergenic
No off target data available for this crispr