ID: 1201145140

View in Genome Browser
Species Human (GRCh38)
Location Y:11060422-11060444
Sequence TCCTCCCCAGCCGGGCACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201145140_1201145145 1 Left 1201145140 Y:11060422-11060444 CCACAGTGCCCGGCTGGGGAGGA No data
Right 1201145145 Y:11060446-11060468 CTGATTTTTATCCTCACACTGGG No data
1201145140_1201145149 18 Left 1201145140 Y:11060422-11060444 CCACAGTGCCCGGCTGGGGAGGA No data
Right 1201145149 Y:11060463-11060485 ACTGGGAAGAAGTCACAGGAGGG No data
1201145140_1201145144 0 Left 1201145140 Y:11060422-11060444 CCACAGTGCCCGGCTGGGGAGGA No data
Right 1201145144 Y:11060445-11060467 CCTGATTTTTATCCTCACACTGG No data
1201145140_1201145147 14 Left 1201145140 Y:11060422-11060444 CCACAGTGCCCGGCTGGGGAGGA No data
Right 1201145147 Y:11060459-11060481 TCACACTGGGAAGAAGTCACAGG No data
1201145140_1201145148 17 Left 1201145140 Y:11060422-11060444 CCACAGTGCCCGGCTGGGGAGGA No data
Right 1201145148 Y:11060462-11060484 CACTGGGAAGAAGTCACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201145140 Original CRISPR TCCTCCCCAGCCGGGCACTG TGG (reversed) Intergenic