ID: 1201147286

View in Genome Browser
Species Human (GRCh38)
Location Y:11072259-11072281
Sequence TTAAATGAACAGAAGGAAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201147286_1201147294 24 Left 1201147286 Y:11072259-11072281 CCGGCTTCCTTCTGTTCATTTAA No data
Right 1201147294 Y:11072306-11072328 GCAAAACACATCAGCTGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201147286 Original CRISPR TTAAATGAACAGAAGGAAGC CGG (reversed) Intergenic
No off target data available for this crispr