ID: 1201147566

View in Genome Browser
Species Human (GRCh38)
Location Y:11073206-11073228
Sequence TCTCCATGTTGAGGGCGTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201147566_1201147580 20 Left 1201147566 Y:11073206-11073228 CCGCCACGCCCTCAACATGGAGA No data
Right 1201147580 Y:11073249-11073271 TGAAGCAGAACCTGGCGGGGAGG No data
1201147566_1201147582 26 Left 1201147566 Y:11073206-11073228 CCGCCACGCCCTCAACATGGAGA No data
Right 1201147582 Y:11073255-11073277 AGAACCTGGCGGGGAGGTCTGGG No data
1201147566_1201147579 17 Left 1201147566 Y:11073206-11073228 CCGCCACGCCCTCAACATGGAGA No data
Right 1201147579 Y:11073246-11073268 AACTGAAGCAGAACCTGGCGGGG No data
1201147566_1201147577 15 Left 1201147566 Y:11073206-11073228 CCGCCACGCCCTCAACATGGAGA No data
Right 1201147577 Y:11073244-11073266 GTAACTGAAGCAGAACCTGGCGG No data
1201147566_1201147581 25 Left 1201147566 Y:11073206-11073228 CCGCCACGCCCTCAACATGGAGA No data
Right 1201147581 Y:11073254-11073276 CAGAACCTGGCGGGGAGGTCTGG No data
1201147566_1201147576 12 Left 1201147566 Y:11073206-11073228 CCGCCACGCCCTCAACATGGAGA No data
Right 1201147576 Y:11073241-11073263 CCAGTAACTGAAGCAGAACCTGG No data
1201147566_1201147578 16 Left 1201147566 Y:11073206-11073228 CCGCCACGCCCTCAACATGGAGA No data
Right 1201147578 Y:11073245-11073267 TAACTGAAGCAGAACCTGGCGGG No data
1201147566_1201147583 27 Left 1201147566 Y:11073206-11073228 CCGCCACGCCCTCAACATGGAGA No data
Right 1201147583 Y:11073256-11073278 GAACCTGGCGGGGAGGTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201147566 Original CRISPR TCTCCATGTTGAGGGCGTGG CGG (reversed) Intergenic
No off target data available for this crispr