ID: 1201147899

View in Genome Browser
Species Human (GRCh38)
Location Y:11075494-11075516
Sequence AGTGACATGCCCAAGGTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201147890_1201147899 27 Left 1201147890 Y:11075444-11075466 CCTACCCATCTCACAGTTCTGCA No data
Right 1201147899 Y:11075494-11075516 AGTGACATGCCCAAGGTAAAAGG No data
1201147892_1201147899 22 Left 1201147892 Y:11075449-11075471 CCATCTCACAGTTCTGCAGAAAC No data
Right 1201147899 Y:11075494-11075516 AGTGACATGCCCAAGGTAAAAGG No data
1201147896_1201147899 -7 Left 1201147896 Y:11075478-11075500 CCATGACCAGAAAGGGAGTGACA No data
Right 1201147899 Y:11075494-11075516 AGTGACATGCCCAAGGTAAAAGG No data
1201147891_1201147899 23 Left 1201147891 Y:11075448-11075470 CCCATCTCACAGTTCTGCAGAAA No data
Right 1201147899 Y:11075494-11075516 AGTGACATGCCCAAGGTAAAAGG No data
1201147894_1201147899 0 Left 1201147894 Y:11075471-11075493 CCATTCACCATGACCAGAAAGGG No data
Right 1201147899 Y:11075494-11075516 AGTGACATGCCCAAGGTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201147899 Original CRISPR AGTGACATGCCCAAGGTAAA AGG Intergenic
No off target data available for this crispr