ID: 1201150294

View in Genome Browser
Species Human (GRCh38)
Location Y:11091912-11091934
Sequence TCTCATGTCCACCTGGGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201150294_1201150303 26 Left 1201150294 Y:11091912-11091934 CCAGCGCCCAGGTGGACATGAGA No data
Right 1201150303 Y:11091961-11091983 ATCTAAGACTGAATTCCCCTAGG No data
1201150294_1201150304 27 Left 1201150294 Y:11091912-11091934 CCAGCGCCCAGGTGGACATGAGA No data
Right 1201150304 Y:11091962-11091984 TCTAAGACTGAATTCCCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201150294 Original CRISPR TCTCATGTCCACCTGGGCGC TGG (reversed) Intergenic
No off target data available for this crispr