ID: 1201152609

View in Genome Browser
Species Human (GRCh38)
Location Y:11102193-11102215
Sequence TGCCCAGCGCAGGGGCTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201152590_1201152609 23 Left 1201152590 Y:11102147-11102169 CCCAAGGCTCTCCCTGAGCTCAA No data
Right 1201152609 Y:11102193-11102215 TGCCCAGCGCAGGGGCTGATGGG No data
1201152599_1201152609 -8 Left 1201152599 Y:11102178-11102200 CCCCAGGTTCCCCGGTGCCCAGC No data
Right 1201152609 Y:11102193-11102215 TGCCCAGCGCAGGGGCTGATGGG No data
1201152594_1201152609 12 Left 1201152594 Y:11102158-11102180 CCCTGAGCTCAAACCAGGGACCC No data
Right 1201152609 Y:11102193-11102215 TGCCCAGCGCAGGGGCTGATGGG No data
1201152595_1201152609 11 Left 1201152595 Y:11102159-11102181 CCTGAGCTCAAACCAGGGACCCC No data
Right 1201152609 Y:11102193-11102215 TGCCCAGCGCAGGGGCTGATGGG No data
1201152600_1201152609 -9 Left 1201152600 Y:11102179-11102201 CCCAGGTTCCCCGGTGCCCAGCG No data
Right 1201152609 Y:11102193-11102215 TGCCCAGCGCAGGGGCTGATGGG No data
1201152601_1201152609 -10 Left 1201152601 Y:11102180-11102202 CCAGGTTCCCCGGTGCCCAGCGC No data
Right 1201152609 Y:11102193-11102215 TGCCCAGCGCAGGGGCTGATGGG No data
1201152591_1201152609 22 Left 1201152591 Y:11102148-11102170 CCAAGGCTCTCCCTGAGCTCAAA No data
Right 1201152609 Y:11102193-11102215 TGCCCAGCGCAGGGGCTGATGGG No data
1201152598_1201152609 -1 Left 1201152598 Y:11102171-11102193 CCAGGGACCCCAGGTTCCCCGGT No data
Right 1201152609 Y:11102193-11102215 TGCCCAGCGCAGGGGCTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201152609 Original CRISPR TGCCCAGCGCAGGGGCTGAT GGG Intergenic
No off target data available for this crispr