ID: 1201157136

View in Genome Browser
Species Human (GRCh38)
Location Y:11141387-11141409
Sequence GTGTGGTAGGTGGTGGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201157130_1201157136 16 Left 1201157130 Y:11141348-11141370 CCAAGATTTTTATATCTTGAAAC No data
Right 1201157136 Y:11141387-11141409 GTGTGGTAGGTGGTGGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201157136 Original CRISPR GTGTGGTAGGTGGTGGTGGT TGG Intergenic
No off target data available for this crispr