ID: 1201160467

View in Genome Browser
Species Human (GRCh38)
Location Y:11161051-11161073
Sequence TTTGCAGCTGGCAGGAGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201160467_1201160482 23 Left 1201160467 Y:11161051-11161073 CCCTGACTCCTGCCAGCTGCAAA No data
Right 1201160482 Y:11161097-11161119 ATGGGGTGAAGACACCCTGAAGG No data
1201160467_1201160475 6 Left 1201160467 Y:11161051-11161073 CCCTGACTCCTGCCAGCTGCAAA No data
Right 1201160475 Y:11161080-11161102 AAGCCCCCAGCCCTCTCATGGGG 0: 5
1: 2
2: 1
3: 19
4: 219
1201160467_1201160473 4 Left 1201160467 Y:11161051-11161073 CCCTGACTCCTGCCAGCTGCAAA No data
Right 1201160473 Y:11161078-11161100 CAAAGCCCCCAGCCCTCTCATGG 0: 5
1: 1
2: 0
3: 19
4: 311
1201160467_1201160474 5 Left 1201160467 Y:11161051-11161073 CCCTGACTCCTGCCAGCTGCAAA No data
Right 1201160474 Y:11161079-11161101 AAAGCCCCCAGCCCTCTCATGGG 0: 5
1: 1
2: 0
3: 18
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201160467 Original CRISPR TTTGCAGCTGGCAGGAGTCA GGG (reversed) Intergenic
No off target data available for this crispr