ID: 1201160470

View in Genome Browser
Species Human (GRCh38)
Location Y:11161063-11161085
Sequence GGGCTTTGGGATTTTGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201160470_1201160473 -8 Left 1201160470 Y:11161063-11161085 CCAGCTGCAAAATCCCAAAGCCC No data
Right 1201160473 Y:11161078-11161100 CAAAGCCCCCAGCCCTCTCATGG No data
1201160470_1201160482 11 Left 1201160470 Y:11161063-11161085 CCAGCTGCAAAATCCCAAAGCCC No data
Right 1201160482 Y:11161097-11161119 ATGGGGTGAAGACACCCTGAAGG No data
1201160470_1201160474 -7 Left 1201160470 Y:11161063-11161085 CCAGCTGCAAAATCCCAAAGCCC No data
Right 1201160474 Y:11161079-11161101 AAAGCCCCCAGCCCTCTCATGGG No data
1201160470_1201160475 -6 Left 1201160470 Y:11161063-11161085 CCAGCTGCAAAATCCCAAAGCCC No data
Right 1201160475 Y:11161080-11161102 AAGCCCCCAGCCCTCTCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201160470 Original CRISPR GGGCTTTGGGATTTTGCAGC TGG (reversed) Intergenic