ID: 1201160473

View in Genome Browser
Species Human (GRCh38)
Location Y:11161078-11161100
Sequence CAAAGCCCCCAGCCCTCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 5, 1: 1, 2: 0, 3: 19, 4: 311}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201160468_1201160473 3 Left 1201160468 Y:11161052-11161074 CCTGACTCCTGCCAGCTGCAAAA No data
Right 1201160473 Y:11161078-11161100 CAAAGCCCCCAGCCCTCTCATGG 0: 5
1: 1
2: 0
3: 19
4: 311
1201160467_1201160473 4 Left 1201160467 Y:11161051-11161073 CCCTGACTCCTGCCAGCTGCAAA No data
Right 1201160473 Y:11161078-11161100 CAAAGCCCCCAGCCCTCTCATGG 0: 5
1: 1
2: 0
3: 19
4: 311
1201160470_1201160473 -8 Left 1201160470 Y:11161063-11161085 CCAGCTGCAAAATCCCAAAGCCC No data
Right 1201160473 Y:11161078-11161100 CAAAGCCCCCAGCCCTCTCATGG 0: 5
1: 1
2: 0
3: 19
4: 311
1201160469_1201160473 -4 Left 1201160469 Y:11161059-11161081 CCTGCCAGCTGCAAAATCCCAAA No data
Right 1201160473 Y:11161078-11161100 CAAAGCCCCCAGCCCTCTCATGG 0: 5
1: 1
2: 0
3: 19
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201160473 Original CRISPR CAAAGCCCCCAGCCCTCTCA TGG Intergenic
900163375 1:1235116-1235138 GGAAGCCCCCAGCCCTCCCGAGG - Intergenic
900395478 1:2451608-2451630 GAGAGCCCCCAGCCCACCCATGG - Intronic
900503697 1:3018784-3018806 CCAAGACCCCAGCCCGCCCAGGG + Intergenic
900932578 1:5746412-5746434 CACAGCCCCCAGGCCACTGATGG + Intergenic
900958298 1:5902105-5902127 CCCAGCCCCCATGCCTCTCAGGG + Intronic
901052471 1:6432238-6432260 CACAGCCTCCAGCCTTCTAAGGG - Intronic
901448658 1:9323217-9323239 CAAAGCCGCCAGCCCAGCCAGGG - Intronic
902481768 1:16715780-16715802 CAGAGCCTCCAGCCTTCTAAGGG + Intergenic
902830585 1:19009883-19009905 CAAGGCCACAAGCTCTCTCAGGG - Intergenic
903688345 1:25149584-25149606 CAAAGCCCAGAGCCCACCCAAGG + Intergenic
905234226 1:36534809-36534831 CAAAGTCCCCAGCACACTCTGGG + Intergenic
905869443 1:41394779-41394801 CAGATCCCCCAGCCCTGTCCCGG + Intergenic
906528734 1:46511301-46511323 CCCAGACCCCAGCCCTCCCATGG - Intronic
908782326 1:67701939-67701961 CAAAGACCCCACCCCTCTGCTGG - Exonic
909376476 1:74947931-74947953 GAAAGTCCCCTGCCCTCCCAGGG + Intergenic
914981690 1:152420155-152420177 CAAAGCACCCATCCCTTCCAGGG + Intergenic
914981968 1:152422887-152422909 CAAAGCACCCATCCCTTCCAGGG - Intergenic
915949284 1:160177434-160177456 CCCAGCCCCCAGCCCTCCCCTGG + Intronic
917539635 1:175900259-175900281 CTAAGCTCCCAGCCCTCACCAGG - Intergenic
919130154 1:193440982-193441004 CAAAGCCACCAGTTCTATCATGG - Intergenic
919381604 1:196867898-196867920 CAAAGCCACCAGCCCTCACTGGG - Intronic
919788769 1:201276833-201276855 CTCAGCCCCCAGCTCTCTCTGGG - Intergenic
919913935 1:202128697-202128719 CAAAGCCCCCTCCCCACACAGGG + Exonic
920031510 1:203040166-203040188 CACAACCCCCAGCCCTCTCTGGG - Intronic
920180178 1:204127568-204127590 CAAAGCCCCCACTTCTCTCCAGG + Exonic
920298502 1:204974468-204974490 GCAAGCCTCCATCCCTCTCAAGG - Intronic
920801643 1:209194044-209194066 CCAAGCCCCATGCCCTCTCTGGG + Intergenic
922866827 1:228867698-228867720 CAAAGCACACAGCCCTCTTTAGG + Intergenic
924567974 1:245213651-245213673 AAAGGCTCCCAGCGCTCTCAGGG - Intronic
1063178111 10:3570550-3570572 CCAAGACCCCTGTCCTCTCAGGG - Intergenic
1065092947 10:22252839-22252861 CCAGGCCCCCAGGCCTCTCGCGG + Intergenic
1066526259 10:36283109-36283131 CAAAGGACCCTGCCCTCCCAGGG + Intergenic
1066658720 10:37719821-37719843 CTAAGCCCCCATCCCTTTCTTGG + Intergenic
1066962331 10:42234429-42234451 CACAGCCCCTGGCCCTGTCATGG - Intergenic
1067441881 10:46313105-46313127 CAAAGCTCCCATCCCCCTCTGGG - Intronic
1067572035 10:47378655-47378677 CAGAGAGCCCAACCCTCTCATGG + Intronic
1068874947 10:61986038-61986060 CAAAGCCACCAGCCCACTGGAGG + Intronic
1071571314 10:86698993-86699015 CACAGCCCCCAACTCACTCAAGG + Intronic
1073582530 10:104681373-104681395 CCCAGGCCCCAGCCCTCCCACGG + Intronic
1074544644 10:114393225-114393247 CAAAGCCACCAACACTCTCCTGG + Intronic
1075077546 10:119361035-119361057 CAAAGCCCACAGTACTCCCAGGG - Intronic
1076211139 10:128645938-128645960 CAAGGCCCACAGCCTTCTGAAGG + Intergenic
1076904381 10:133354944-133354966 AGAAGTCCCCACCCCTCTCAAGG + Intergenic
1077093786 11:790921-790943 CACACCCCCAAGTCCTCTCAGGG - Exonic
1077279270 11:1734745-1734767 CAAAGCCTCCAGACTTCTCCAGG + Exonic
1077440385 11:2566104-2566126 CAGAGCCTCCAGCCCTGCCAGGG - Intronic
1079098933 11:17528743-17528765 CACAGACCCCAGTCTTCTCAGGG + Intronic
1080004377 11:27391102-27391124 CAAAGCACTCAGCCCTCGAATGG + Exonic
1080960550 11:37153278-37153300 CAAAGACCACAGACCCCTCAAGG - Intergenic
1081626671 11:44660032-44660054 CCAGGCCCCCATCCCTCACAGGG + Intergenic
1081656633 11:44861832-44861854 CACAGCCCCCATGCCTCTGATGG + Intronic
1083620952 11:64049148-64049170 GAAGTCCCCCAGACCTCTCAGGG - Intronic
1083882370 11:65554946-65554968 CACAGCCCCCAGCCTTTCCAGGG + Intronic
1085792620 11:79508917-79508939 CAAAGCCTACAGTCCTCCCAAGG - Intergenic
1086001780 11:81992534-81992556 CACCACGCCCAGCCCTCTCAGGG - Intergenic
1086454281 11:86946177-86946199 CAAAGCCCACAGCCAAGTCAGGG + Exonic
1087491425 11:98832238-98832260 CAAAGCCCCCAGATCCCCCAAGG + Intergenic
1088750824 11:112841060-112841082 CAAAGCCCCCAGCCTTTTGGAGG + Intergenic
1090998092 11:131885246-131885268 CAAAGACTCCTGCCCTCACAGGG + Intronic
1091601839 12:1922514-1922536 CCACGGCCCCAGCCCTCCCACGG - Intergenic
1091780757 12:3213320-3213342 CTCTGCCCCCTGCCCTCTCAAGG + Intronic
1092065188 12:5584224-5584246 CAGAGCCGCCAGCCCTCACATGG - Intronic
1092217803 12:6694967-6694989 CACAGCCCCCATCCCACTGAGGG - Exonic
1092217879 12:6695295-6695317 CACAGCCCCTGGCCCTCCCAAGG - Intronic
1094254390 12:28405659-28405681 CAAAGCATCCATCCCTTTCAGGG + Intronic
1095300875 12:40582140-40582162 CTAAGCCTCCAGGCCTCTGATGG + Intergenic
1096743500 12:53711195-53711217 CAAGGCCCCCCTCCCTCTCCAGG - Intronic
1097267343 12:57753954-57753976 CAAAGCACCCACCCCTAGCAAGG - Intronic
1097685495 12:62687138-62687160 GAAAGCTCTCAGCCCTCACATGG - Intronic
1101469946 12:104986620-104986642 CAAAGCCCCCACCCCTGCCGCGG - Intronic
1102345544 12:112158850-112158872 GAAAGGCACCAGCCCTGTCAAGG - Intergenic
1103443695 12:120980588-120980610 CAAAGCCCCCAGTCCCATCTGGG - Intronic
1103794112 12:123491495-123491517 CAAAGCACCCTGCCCTCCCACGG + Intronic
1103907970 12:124336973-124336995 CCAAGCCCCCAGCCCGCTCCGGG - Exonic
1107332500 13:39316908-39316930 TCAAAGCCCCAGCCCTCTCATGG - Intergenic
1109280767 13:60352289-60352311 CAAGGCCCCCAGCCTTCACGAGG - Intergenic
1113719056 13:112539069-112539091 CAAAGCCCACAGACATCTTAGGG + Intronic
1115820029 14:37204068-37204090 CACTGCGCCCAGCCCCCTCAGGG + Intronic
1115951718 14:38728596-38728618 CCTAGCCCTCAGCCCACTCACGG + Intergenic
1117225173 14:53651006-53651028 TAAAGCCACCAGTCCCCTCACGG + Intergenic
1117725441 14:58668638-58668660 CAAAGCCCCCAGAGCTGACAAGG - Intergenic
1118443930 14:65835205-65835227 CACAGCCCACAGGCCTCTCCAGG - Intergenic
1119655651 14:76414885-76414907 GCAAGTCCCCGGCCCTCTCAGGG + Intronic
1119880027 14:78092520-78092542 CAAAGTCCCAAGCCCTCCCTAGG + Intergenic
1120398431 14:83997701-83997723 CAAATCCTCCAGCACTCACATGG - Intergenic
1121454248 14:94028128-94028150 CAAAGCCCTCACCCCTCACCGGG + Intronic
1122362220 14:101174254-101174276 GAAAGCCCCTTGCCCTCTCTGGG - Intergenic
1122801727 14:104234123-104234145 CAAAGCCTCCAGGCCTGTGATGG - Intergenic
1123036566 14:105474250-105474272 CACGGCCCCCAGCCCTGTCCGGG - Intronic
1202904599 14_GL000194v1_random:60888-60910 CAAAGCCCCCAGCCCTCTCATGG + Intergenic
1123945611 15:25237464-25237486 CAAGGCCACCAGCCAGCTCACGG - Intergenic
1124016138 15:25877410-25877432 CACTGCACCCAGCCCTCTCTGGG - Intergenic
1126416289 15:48421024-48421046 CAAAGCCCAAAGCACTCTCTGGG + Intronic
1127619622 15:60720914-60720936 CAAAACCCCCAGCCAGCTCTCGG + Intronic
1127770825 15:62229277-62229299 CAAAGGCTCAAGCCCTCTCTAGG + Intergenic
1128090473 15:64915640-64915662 CACAGCCCTCCTCCCTCTCAAGG - Intronic
1128152662 15:65372966-65372988 CAAACCCCCCAGCTGTCTCCAGG + Intronic
1128203871 15:65833151-65833173 CAAGGCCACAAGCCCTCTCTGGG + Intronic
1128347152 15:66861508-66861530 CCAAGCCCCCAGCTTTCTCTGGG - Intergenic
1128356806 15:66933868-66933890 CAAAGCCCCCACTACCCTCAGGG + Intergenic
1131912626 15:97224518-97224540 CCAAGCCCCCAGACCCCGCATGG + Intergenic
1132470137 16:97983-98005 CAAAACCTCCAGCCATCCCAGGG + Intronic
1132630808 16:916405-916427 AAAAGCTCCCAGCTCTCTCTGGG - Intronic
1132889076 16:2195568-2195590 CCAAGCTCCCAGCCCTTTCCTGG + Intronic
1133451484 16:5907487-5907509 CATAGGCCCAAGCCCTCTGAAGG - Intergenic
1134218884 16:12337959-12337981 CAAAGACCGCAGCACTTTCAAGG - Intronic
1135400528 16:22163415-22163437 CACTGCGCCCAGCCCACTCATGG - Intergenic
1136723493 16:32340835-32340857 CACAGCCCCTGGCCCTGTCATGG - Intergenic
1136841827 16:33546891-33546913 CACAGCCCCTGGCCCTGTCATGG - Intergenic
1136862491 16:33712084-33712106 CACAGCCCCTGGCCCTGTCATGG + Intergenic
1137404013 16:48176093-48176115 GCCAGACCCCAGCCCTCTCAGGG + Intronic
1138302961 16:55947880-55947902 CAAAACTCCCAGCCCTTCCATGG - Intronic
1139314732 16:66058625-66058647 CAAAGACCCCAACCCAATCAAGG + Intergenic
1139661395 16:68423419-68423441 TAAAGCCGCCAGCCCCATCATGG - Intronic
1139797677 16:69496613-69496635 CACAGCCTCCATCCCCCTCAAGG - Intergenic
1140034317 16:71360971-71360993 AAAAGCCCCCAGCCCACCCTTGG + Intronic
1140335104 16:74097711-74097733 CAAAGCACCCAGCACACTAAAGG - Intergenic
1140963744 16:79943732-79943754 GAAAGCCCCCTCCCCTCTCTGGG - Intergenic
1141628221 16:85272649-85272671 CCAAGCCCCCAGCACTGCCAGGG - Intergenic
1141629052 16:85276958-85276980 CAAAGCCCCCAGGCCTGGCCCGG - Intergenic
1141697701 16:85627958-85627980 CGAAGCCCCCAGCCCTCCCCAGG - Intronic
1142398695 16:89847948-89847970 CAAAGCCCCCAACCCCCACACGG - Intronic
1203002939 16_KI270728v1_random:176930-176952 CACAGCCCCTGGCCCTGTCATGG + Intergenic
1203134544 16_KI270728v1_random:1713336-1713358 CACAGCCCCTGGCCCTGTCATGG + Intergenic
1203151992 16_KI270728v1_random:1847188-1847210 CACAGCCCCTGGCCCTGTCATGG - Intergenic
1143280714 17:5752286-5752308 CAGAGCCCCCTACCCTCCCAGGG + Intergenic
1144192251 17:12857474-12857496 TAAAGCCACCAGTCCTATCATGG + Intronic
1144711488 17:17404303-17404325 CAGACCCCTCAGCCCTCTGATGG + Intergenic
1145267232 17:21385694-21385716 CACAGCCTCCAGGCCACTCATGG + Intronic
1145440440 17:23098304-23098326 CAAACCTCACAGCCCTCCCAAGG - Intergenic
1145441305 17:23110203-23110225 CAAACCTCACAGCCCTCCCAAGG - Intergenic
1145816240 17:27797066-27797088 CCCAGCCCCCAGCCCACTCCTGG + Intronic
1146109002 17:30070004-30070026 CAGAGCCCCCAGTTGTCTCAGGG + Intronic
1146588123 17:34100654-34100676 GGGAGCCCTCAGCCCTCTCAGGG - Intronic
1147258556 17:39196135-39196157 CAAAGCCCCCAGTCTGGTCATGG - Intronic
1148209041 17:45797133-45797155 CCCAGCCCCCTGCCCACTCAGGG - Intronic
1150416176 17:64990555-64990577 CTATGTCCCCAGCCCTCTGAAGG - Intergenic
1150578834 17:66454164-66454186 CCAAGCCCACTGCCCTCTCTGGG + Intronic
1150795496 17:68233582-68233604 CTATGTCCCCAGCCCTCTGAGGG + Intergenic
1151085066 17:71370882-71370904 CACAGCCCCCACACCTCTCCCGG + Intergenic
1151177646 17:72301865-72301887 CAAGTCCCCCAGAACTCTCAGGG - Intergenic
1151643043 17:75410439-75410461 CAAAGCCACCAGCACTATCCTGG - Intergenic
1152795768 17:82305410-82305432 CACAGACCTCAGCCCTCTTAAGG + Intergenic
1153056449 18:950472-950494 GAGAACCCCCAGCCCTCGCAAGG - Intergenic
1155935937 18:31754143-31754165 TAAAGCCACCAGCCCCATCATGG + Intergenic
1156243557 18:35276416-35276438 CTAAGCCCCAAGCCCTGTGATGG - Intronic
1156505090 18:37585484-37585506 CAGGGCACCCAGCCCTCTGATGG - Intergenic
1156921211 18:42524474-42524496 CAAAGCCACGATCCCTCTGAAGG + Intergenic
1157321566 18:46638902-46638924 CAAAGTCCCTTCCCCTCTCATGG + Intronic
1158844122 18:61423251-61423273 GAGGGCCCCCTGCCCTCTCAGGG + Intronic
1160939142 19:1611997-1612019 CCATCCCCCCAGCCTTCTCAAGG - Intronic
1161315381 19:3614975-3614997 CACACCCCCCAACCCCCTCATGG - Intronic
1161557234 19:4950783-4950805 CAGAGCCCCCGGCCTCCTCAAGG - Intronic
1161561009 19:4972436-4972458 CAAGGCCCTCTGCCCTGTCAGGG + Intronic
1162142886 19:8595431-8595453 CAAAGTCTCAAGACCTCTCACGG - Intronic
1162183943 19:8889873-8889895 TATAGCCGCCAGCCCTCTCCTGG - Exonic
1163560843 19:18018577-18018599 CAAAAACCCCAACCCTCTCCAGG + Intergenic
1163741503 19:19016442-19016464 ACCAGCCCCCAGGCCTCTCAGGG + Intronic
1165797163 19:38526039-38526061 CTAAGCCCCCAAGACTCTCAGGG + Intronic
1166337418 19:42116799-42116821 CACAGCCCCCAGCCTCCTCTGGG - Intronic
1166688679 19:44810347-44810369 CAGAGCCCCCAGCCGCCTCTTGG - Intronic
1166810038 19:45509021-45509043 CAAAGCCCCCAGCCTGAGCAGGG + Intronic
1202715807 1_KI270714v1_random:41692-41714 CAGAGCCTCCAGCCTTCTAAGGG + Intergenic
925857495 2:8144271-8144293 AAAAGAGCCCAGCCCACTCATGG - Intergenic
925913175 2:8586606-8586628 TACAGCTGCCAGCCCTCTCATGG - Intergenic
926211441 2:10873696-10873718 CACAGCCCCTAATCCTCTCAAGG - Intergenic
927673970 2:25091178-25091200 CAAGGCCCCGAGCCCTCCAAGGG + Intronic
928402239 2:30987565-30987587 TTAAGCCCCCAGGCCTCTCTGGG + Intronic
928743278 2:34381153-34381175 CAAAAGCACCAGCTCTCTCAGGG - Intergenic
929325074 2:40600076-40600098 CAACTCACTCAGCCCTCTCATGG - Intronic
929598886 2:43192819-43192841 CCAAGCCCCCAGCCCTCCTCTGG - Intergenic
930203024 2:48562614-48562636 CAAAGTCACCTGGCCTCTCATGG - Intronic
934026452 2:88005471-88005493 CACCGCCCCCGGCCCTCTGATGG - Intergenic
934322625 2:91982701-91982723 CACAGCCCCTGGCCCTGTCATGG + Intergenic
934502042 2:94869507-94869529 CAAAGCCCCCAGCCCTCTCATGG - Intergenic
934778847 2:96956147-96956169 CAAAGCCCACATCCCACTCGGGG - Intronic
934915293 2:98296589-98296611 CAAAGCCCTGTGTCCTCTCATGG - Intronic
938110242 2:128559554-128559576 CAATGCCCCCAGCTCTTTCAAGG - Intergenic
939923089 2:148141171-148141193 CAAAACCCACAGCAATCTCAAGG - Intronic
941164977 2:162074451-162074473 CAAAGTCCCCTGCCCTCTCTGGG - Exonic
942148529 2:173050906-173050928 CAATGCACTCAGCCCTCGCAGGG - Intronic
942161613 2:173194864-173194886 CAAAACCACCAGCCCTCCCCAGG + Intronic
942459676 2:176160376-176160398 CAACGCCCCCAACCCACTGAGGG + Intronic
944288098 2:197974810-197974832 CCAAGCTCCCAGGCCTGTCAGGG - Intronic
948342427 2:237265111-237265133 CAAGGCCTCCAGCCCGCTCCTGG + Intergenic
948612822 2:239180606-239180628 TAAAGCCCCCAGCCCAGACAAGG + Intronic
948916880 2:241038959-241038981 CCAAGCCTCAAGCCCTCTTAGGG - Intronic
1170917940 20:20646310-20646332 CAATGCGCCCAGCCCTCTGTAGG + Intronic
1173093026 20:39993910-39993932 AAAACCCGCCAGCCCTCTCCAGG + Intergenic
1173174965 20:40757649-40757671 CAGAGCCCCCAGCCTTCTAATGG - Intergenic
1174063331 20:47847284-47847306 CAAAGCCCCCAACCCTCCTTGGG - Intergenic
1174072384 20:47908381-47908403 CAAAGCCCCCAACCCTCCTTGGG + Intergenic
1174151681 20:48490317-48490339 CAAAGCCCCCAACCCTCCTTGGG - Intergenic
1175214680 20:57385647-57385669 CAAACGCCCCAACTCTCTCAGGG - Intergenic
1175395859 20:58661060-58661082 CAAGCCCCCAAGCCCTCTCCAGG - Intronic
1175424518 20:58855149-58855171 CAAAGCCTCGCGCTCTCTCAAGG + Exonic
1175625800 20:60487375-60487397 CAAAGCCTCCCGACCACTCAAGG + Intergenic
1175926499 20:62474070-62474092 CCAACCCCCCACCCCTGTCATGG - Intronic
1176623969 21:9075655-9075677 CAAAGCCCCCAGCCCTTTCATGG + Intergenic
1179966168 21:44807469-44807491 CAAAGCCCCCAGCTCACAGAAGG + Intronic
1180742134 22:18061193-18061215 CAAAAGCTCCAGCCATCTCATGG + Intergenic
1181750656 22:24986868-24986890 CAAAGCCCCTTGCCCTCTGGAGG + Intronic
1182380496 22:29883474-29883496 CGCAGTCCCCAGCCCTCCCAGGG - Intronic
1182638667 22:31749875-31749897 CCAGGCCCCCCGCCCTCTCGGGG - Intronic
1182699955 22:32228660-32228682 CAAGGCCCCCAGGCTGCTCAGGG + Intronic
1182939799 22:34264688-34264710 CAAAGCTTCCACCCATCTCATGG + Intergenic
1183510780 22:38233494-38233516 CACAGCCCTCAGCCCTGTCTAGG - Intronic
1183942340 22:41302532-41302554 CCAGGCCCCCAGCCCCGTCAGGG - Intronic
1184212413 22:43043767-43043789 TAAAGCCCCCAGCTCTTTCCAGG + Intronic
1184694880 22:46133641-46133663 CAAAGGCCCCAGCTCTCACTTGG + Intergenic
1184854061 22:47136881-47136903 CAGAGCCCCCAGACCTGTCCCGG + Intronic
950531079 3:13552689-13552711 CACAGCTCCCAGCCCTCCCGAGG - Intronic
952885198 3:38007726-38007748 CAGAGGGCCCAGCCCACTCAGGG + Exonic
954135929 3:48582202-48582224 CAGAGCTCCCAGCCTGCTCACGG + Intronic
954747209 3:52794070-52794092 CCAAGCCCCAAGCCCCCTGAGGG - Intergenic
955343541 3:58143943-58143965 CCAAGCCTCCAGCCCACACAGGG - Intronic
956410510 3:68973839-68973861 CTAAGGCCCCACCCCTCTCTGGG + Intergenic
956886771 3:73568168-73568190 CAAAGCCACAAGCCACCTCAGGG + Intronic
961566813 3:127769840-127769862 CAGACCCCCCAGCACTCTGACGG - Intronic
962094762 3:132281821-132281843 CACAGCCCTCAGCCCTCAGAAGG - Intronic
966892704 3:184418655-184418677 CACTGTCCCCAGCCCACTCAGGG - Intronic
967113849 3:186319042-186319064 CAAAGCACCAAGCCCTGTCAGGG - Intronic
968446963 4:657060-657082 CACAGGCCCCACCCCTCGCAGGG - Intronic
968466493 4:754182-754204 CAGAACCCCCAGCCTGCTCAGGG - Intronic
968943693 4:3652604-3652626 AAATGCTCCAAGCCCTCTCAAGG + Intergenic
969209517 4:5676086-5676108 CACAGTACCCAGCCCTTTCATGG + Intronic
969304596 4:6318487-6318509 CATTTCTCCCAGCCCTCTCAAGG + Intergenic
971242072 4:24898211-24898233 TAAATCCCCCAACCCTCTCCAGG - Intronic
973924928 4:55727867-55727889 AACCGCCTCCAGCCCTCTCAGGG - Intergenic
975004038 4:69265082-69265104 CAAAGACACCAGGCCCCTCAGGG - Intergenic
975718026 4:77224423-77224445 TAAAACTCCCACCCCTCTCATGG - Intronic
976216240 4:82718213-82718235 CACAGCACTCAGCCCTCTGAGGG - Intronic
981146227 4:141327967-141327989 CCAAGCCCTCAGCTCTCACATGG + Intergenic
981391500 4:144196695-144196717 CTAGGCCCCCGGCCCTCTGATGG - Intergenic
985764782 5:1771504-1771526 CAGAGCTCCCAGCCCTGCCAAGG - Intergenic
986284269 5:6348259-6348281 CAGAGCCTCCAGCCCTAGCACGG - Intergenic
991734916 5:69623023-69623045 CACTGCGCCCAGCCCCCTCATGG + Intergenic
991780062 5:70123695-70123717 CACTGCGCCCAGCCCCCTCATGG - Intergenic
991811350 5:70478158-70478180 CACTGCGCCCAGCCCCCTCATGG + Intergenic
991859349 5:70999125-70999147 CACTGCGCCCAGCCCCCTCATGG - Intronic
991872509 5:71124018-71124040 CACTGCGCCCAGCCCCCTCATGG - Intergenic
996822723 5:127648557-127648579 GAAAGCCCCCACCCCACACAGGG - Intergenic
997356749 5:133267338-133267360 CCCAGCCCCAGGCCCTCTCATGG - Intronic
999673911 5:153980495-153980517 CAAAGACCCATTCCCTCTCAGGG + Intergenic
1000003131 5:157158939-157158961 CACAGCACCCAGCCATCACATGG + Intronic
1000920639 5:167132858-167132880 CTAAGCCCCCAGGTCCCTCAGGG + Intergenic
1002352301 5:178591552-178591574 CATAACCCCCGGCCATCTCAGGG - Intergenic
1002844409 6:934282-934304 CAAAGCCCCCAGCACACAGACGG - Intergenic
1005632285 6:27719568-27719590 CAACATCCCCAACCCTCTCAAGG + Intergenic
1006255510 6:32829370-32829392 CACTGTCCCCTGCCCTCTCACGG + Intronic
1006361629 6:33590262-33590284 GAAAGCCTTCAGCCCTCTCCAGG - Intergenic
1006448108 6:34091112-34091134 CCATGCAGCCAGCCCTCTCAGGG + Intronic
1007315613 6:40986234-40986256 AAAAGACACCAGCCCTCACAGGG + Intergenic
1007364889 6:41384415-41384437 CAAAGATCACAGCTCTCTCAAGG - Intergenic
1013415714 6:109922679-109922701 CAAATCCCACTGCCCTCTCAGGG - Intergenic
1014078523 6:117264476-117264498 CGAAGCCAGCAGACCTCTCAGGG + Intergenic
1015439571 6:133232694-133232716 TAAAGCCACCAGCCCCATCATGG + Intergenic
1016519377 6:144929465-144929487 CCAAGCCACCTGCCCTCTCCTGG - Intergenic
1017228173 6:152043758-152043780 CAGTGCCCCCAGCCTTATCAGGG + Intronic
1017744886 6:157437174-157437196 AAAGGCCCCCAGTGCTCTCACGG - Intronic
1018758955 6:166873642-166873664 CAAAGCCCCCAGACCTTGGAAGG + Intronic
1019338129 7:494639-494661 CAGATCCCCCATCCCCCTCACGG - Intergenic
1019357293 7:587330-587352 CACAGCCCCCACCCCTGTCCAGG - Intronic
1019435991 7:1022337-1022359 CACGTCCCACAGCCCTCTCATGG + Intronic
1019494096 7:1329560-1329582 CCAGGCCCCCAGCCTCCTCAGGG - Intergenic
1019640324 7:2100038-2100060 CAAAGCCCAAAACCGTCTCAGGG + Intronic
1019928735 7:4209583-4209605 CAAAACCCCCAGGCCTCTGAGGG + Intronic
1022111805 7:27236533-27236555 CAAAGCCCCTTCCCCTCTCCTGG - Intergenic
1022957661 7:35396263-35396285 CAGAGCCCCCAGCAGTCACAAGG + Intergenic
1023110497 7:36806382-36806404 CAAAGACCTCAGCCATCTTATGG + Intergenic
1023746951 7:43330661-43330683 CAAAGCCCATAGCCCCCACATGG - Intronic
1024273392 7:47659054-47659076 CCAAGCCACCAGCCTTCTCTAGG - Exonic
1024719364 7:52118075-52118097 CTAAGCCCCCAACCTTCTGAAGG + Intergenic
1024975967 7:55113876-55113898 CAAAGCCCCCAGCAGGCTCCAGG - Intronic
1025010018 7:55388971-55388993 TAAAGCCCCCAGCCCCCTCCAGG - Intronic
1025635942 7:63318794-63318816 CCCAGACCCCAGCCTTCTCATGG + Intergenic
1025646754 7:63429386-63429408 CCCAGACCCCAGCCTTCTCATGG - Intergenic
1025969547 7:66309490-66309512 CAATGACCCTAGCCCTCTGAGGG + Intronic
1026463606 7:70635230-70635252 CAAAGGCACAAGCCCTTTCAAGG + Intronic
1026875377 7:73876404-73876426 CAGAGTCCCCACCCCTCTCTAGG + Intergenic
1026945985 7:74316537-74316559 CACTGCCCCCAGCCCTTTTAGGG + Intronic
1027472306 7:78588573-78588595 CCAAGCCCACAGTCCTCTCTGGG - Intronic
1029706515 7:102279472-102279494 CTCAGCCCCCAGGCCTCCCAGGG + Intronic
1030324199 7:108202830-108202852 AAAAGGCCCCTGTCCTCTCAGGG - Intronic
1031115189 7:117659550-117659572 CAAGGCCCTCAGACATCTCAAGG - Intronic
1031845314 7:126798808-126798830 CAACAGCCCCAGCCCTCTAATGG - Intronic
1032283259 7:130523250-130523272 CCATGCCCCCAGCCCTCCCTCGG - Intronic
1032284003 7:130527476-130527498 CCATGCCCCCAGCCCTCCCTCGG - Intronic
1032423020 7:131798393-131798415 CAAAGCCTCAAGCCCAGTCATGG - Intergenic
1034282431 7:149863543-149863565 CAACTCACCCAGCCCTCTCTCGG - Intronic
1034943399 7:155246651-155246673 CTAAGCCCCAAGCTCTCTCTTGG - Intergenic
1035066022 7:156105613-156105635 CAAAGTCCGGAGCCCTCACAGGG - Intergenic
1035559865 8:596226-596248 CACAGGCCCCAGCACTCTCGTGG + Intergenic
1036913085 8:12775292-12775314 CCAAGAACCCACCCCTCTCAGGG + Intergenic
1037814247 8:22103502-22103524 CAAAACTCCCAGCCGCCTCATGG + Exonic
1037982220 8:23262360-23262382 CAAAGCCCCTCTCCCTCACAGGG - Intergenic
1042001411 8:64126642-64126664 CAATGCCCCCAGCTTTGTCAGGG + Intergenic
1048504959 8:135012942-135012964 CTAAGCCTCCAGACCTCTGATGG - Intergenic
1048579142 8:135716543-135716565 AAAAGCATCCAGCCCACTCAGGG - Intergenic
1049161835 8:141102956-141102978 CAAAGCCGGCAGCCCTGTCCAGG + Intergenic
1053462771 9:38283189-38283211 AAAAGACCCCATCCCTCTCTGGG + Intergenic
1055659997 9:78493383-78493405 CAAAGCCCCAAGACCTCTCCTGG - Intergenic
1056236036 9:84595526-84595548 CAGAGTTCCCAGTCCTCTCAGGG - Intergenic
1057126477 9:92619783-92619805 CACCGCCCCCTGACCTCTCACGG + Exonic
1057334938 9:94148251-94148273 CAAAGTCCCCAGTTTTCTCATGG - Intergenic
1057705540 9:97392511-97392533 CCCAGACCTCAGCCCTCTCATGG + Intergenic
1059623642 9:116036603-116036625 CAAAGCCCCCAGCCCCCAGAGGG + Intergenic
1060475950 9:123986771-123986793 CACAGTCCCCAGCCCTCAAAAGG - Intergenic
1061832585 9:133304958-133304980 CAAATCCCCGAGCCCTCGGAGGG + Intergenic
1062044879 9:134420343-134420365 CACAGCCCCCAGCACTCACAGGG - Intronic
1062316080 9:135967530-135967552 CAGAGCCCCCAGCCCCCGTATGG + Intergenic
1062344617 9:136109130-136109152 CCACGCCCACAGCCCTCACAGGG + Intergenic
1203747152 Un_GL000218v1:46083-46105 CAAAGCCCCCAGCCCTCTCATGG + Intergenic
1203562954 Un_KI270744v1:73397-73419 CAAAGCCCCCAGCCCTCTCATGG - Intergenic
1186047057 X:5547990-5548012 CTGAGCCACCAGCCTTCTCAGGG + Intergenic
1189280484 X:39817362-39817384 CAGAGCTCCCAGCTCTCTGAAGG + Intergenic
1189516770 X:41720335-41720357 CTGAGCCCCCTGCCCTCTCCAGG - Intronic
1189576060 X:42354707-42354729 CACCGCACCCAGCCCACTCATGG + Intergenic
1189665943 X:43354898-43354920 CAAAGTCCCCAGCTTTATCAGGG + Intergenic
1192229787 X:69256920-69256942 CCTAGCCCCCAGCCCTGTCCCGG - Intergenic
1196901122 X:120384430-120384452 CAAAGTCACCACTCCTCTCAAGG - Intergenic
1198212453 X:134529037-134529059 CAAAGCCCCCACCCCCATCATGG + Intergenic
1198562468 X:137865950-137865972 CAAGGCCTCCAGTCCTTTCAGGG - Intergenic
1198966839 X:142236770-142236792 CTAAGCCTCCAGGCCTCTGATGG - Intergenic
1199720706 X:150541125-150541147 CAAGGCCCCGAGCCCTCACAGGG - Intergenic
1200274347 X:154717776-154717798 TAAACCTCCCTGCCCTCTCATGG + Intronic
1200750121 Y:6937280-6937302 CAAAGTGCCCAGCCCACCCAGGG - Intronic
1201160473 Y:11161078-11161100 CAAAGCCCCCAGCCCTCTCATGG + Intergenic
1201190119 Y:11437877-11437899 CACAGCCCCTGGCCCTGTCATGG + Intergenic
1202119816 Y:21510450-21510472 CAAGGCCCGCAGGCCTCTCCTGG - Intergenic
1202122267 Y:21533991-21534013 CAAGGCCCGCAGGCCTCTCCTGG - Intronic
1202156738 Y:21895392-21895414 CAAGGCCCGCAGGCCTCTCCTGG + Intronic
1202159186 Y:21918933-21918955 CAAGGCCCGCAGGCCTCTCCTGG + Intergenic
1202185635 Y:22183848-22183870 CAAGGCCCGCAGGCCTCTCCTGG + Intergenic
1202205725 Y:22402548-22402570 CAAGGCCCGCAGGCCTCTCCTGG - Intronic
1202583508 Y:26404050-26404072 CACAGCCCCTGGCCCTGTCATGG - Intergenic