ID: 1201160474

View in Genome Browser
Species Human (GRCh38)
Location Y:11161079-11161101
Sequence AAAGCCCCCAGCCCTCTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 5, 1: 1, 2: 0, 3: 18, 4: 180}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201160470_1201160474 -7 Left 1201160470 Y:11161063-11161085 CCAGCTGCAAAATCCCAAAGCCC No data
Right 1201160474 Y:11161079-11161101 AAAGCCCCCAGCCCTCTCATGGG 0: 5
1: 1
2: 0
3: 18
4: 180
1201160468_1201160474 4 Left 1201160468 Y:11161052-11161074 CCTGACTCCTGCCAGCTGCAAAA No data
Right 1201160474 Y:11161079-11161101 AAAGCCCCCAGCCCTCTCATGGG 0: 5
1: 1
2: 0
3: 18
4: 180
1201160467_1201160474 5 Left 1201160467 Y:11161051-11161073 CCCTGACTCCTGCCAGCTGCAAA No data
Right 1201160474 Y:11161079-11161101 AAAGCCCCCAGCCCTCTCATGGG 0: 5
1: 1
2: 0
3: 18
4: 180
1201160469_1201160474 -3 Left 1201160469 Y:11161059-11161081 CCTGCCAGCTGCAAAATCCCAAA No data
Right 1201160474 Y:11161079-11161101 AAAGCCCCCAGCCCTCTCATGGG 0: 5
1: 1
2: 0
3: 18
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201160474 Original CRISPR AAAGCCCCCAGCCCTCTCAT GGG Intergenic
900375560 1:2352981-2353003 ATGGCCCCCAGCCCTCTCCCAGG + Intronic
900557958 1:3289517-3289539 CAAGCCCCCAGCCCTGGCACAGG - Intronic
900714167 1:4133329-4133351 AGAGCCCCCAGCCTTCAGATAGG - Intergenic
902465377 1:16613973-16613995 AGAGCCCCCAGCTCTCCCAGAGG + Intergenic
902774157 1:18663980-18664002 AAAGCCCCCACCCCACCCACTGG + Intronic
903895935 1:26604487-26604509 AAAGCCCCCAGCATTCTCAGAGG + Intergenic
904292310 1:29495945-29495967 AAAGCCACCAGTCCCATCATAGG + Intergenic
907962555 1:59296929-59296951 AAAGCCCCCAGCGCCCACGTGGG - Intronic
919130153 1:193440981-193441003 AAAGCCACCAGTTCTATCATGGG - Intergenic
919754699 1:201059389-201059411 GAAGCCCCCAACCCTTTCTTGGG + Intronic
919779458 1:201212884-201212906 AAAGCCCCCTGGCCCTTCATGGG - Exonic
921719680 1:218456601-218456623 AAAGCCACCAGTCCCATCATGGG - Intergenic
922178624 1:223216308-223216330 AAACCCTCCCGCCCTCTCACAGG + Intergenic
1062988098 10:1788856-1788878 AAAAAGCACAGCCCTCTCATTGG - Intergenic
1063345915 10:5312368-5312390 AAAGCCACCAGGCCCATCATGGG + Intergenic
1067536173 10:47111832-47111854 ACAGCCCCGACCCCTCACATGGG - Intergenic
1067776810 10:49170265-49170287 AAAGGCCCCAGCCCTGGCCTTGG + Intronic
1070625284 10:78046763-78046785 AATGCCCCCAGGCTTATCATAGG - Intronic
1070653265 10:78253236-78253258 AAAACACCCCGCCCTCTCCTTGG - Intergenic
1071683686 10:87733262-87733284 AAGGCATCCAGCCCTCTCTTTGG + Intronic
1072717335 10:97760581-97760603 AAACCTCTCAGCCCCCTCATGGG - Exonic
1074450404 10:113554891-113554913 AAAGCCCCGAATCCTCTCTTTGG - Intronic
1074544645 10:114393226-114393248 AAAGCCACCAACACTCTCCTGGG + Intronic
1077303801 11:1858913-1858935 AAAGCCCCTGGCCCTTTCTTGGG + Intronic
1079987661 11:27215746-27215768 AGAGCCTCCAGCACTCTCAGTGG - Intergenic
1080375515 11:31705296-31705318 AAAGCCACCAGTCCCATCATGGG + Intronic
1083620951 11:64049147-64049169 AAGTCCCCCAGACCTCTCAGGGG - Intronic
1084933465 11:72574795-72574817 AAAGCCCTCAGCCCTAGCACAGG + Intergenic
1090498490 11:127238239-127238261 ATTGCCCCCAGCTCTCCCATAGG + Intergenic
1094481253 12:30884005-30884027 AAAGCCACCAGTCCCATCATGGG + Intergenic
1095300876 12:40582141-40582163 TAAGCCTCCAGGCCTCTGATGGG + Intergenic
1098012595 12:66070829-66070851 AAAGCCTCCAGTCCCATCATGGG - Intergenic
1099951137 12:89305107-89305129 AAAGCCCCCATCCATACCATTGG + Intergenic
1102345543 12:112158849-112158871 AAAGGCACCAGCCCTGTCAAGGG - Intergenic
1102892209 12:116568678-116568700 AAAGCCACCAGTCCCATCATGGG - Intergenic
1102951188 12:117032782-117032804 AAAGGACCAAGCCCTCTCTTGGG - Intergenic
1103131006 12:118468617-118468639 AAAGCCACCAGTCCCATCATGGG + Intergenic
1103978011 12:124716325-124716347 AAAGCCCCCAGCACTGTGCTGGG - Intergenic
1104680864 12:130750612-130750634 AAGGCCCCCAGCCTTCTGAATGG - Intergenic
1106132840 13:26953829-26953851 AAGGCCCCCAGCCCTGTCCTTGG - Intergenic
1107523493 13:41206192-41206214 AAAGCCACCAGTCCCATCATGGG - Intergenic
1113045081 13:106146822-106146844 AAACCCCCATGCCCTCTCTTTGG + Intergenic
1113755579 13:112808642-112808664 AAAGCCCCCTGCACTCACAGAGG + Intronic
1113983534 13:114295886-114295908 CCAGCCCCTAGTCCTCTCATTGG - Intronic
1114619730 14:24088226-24088248 AAAGGCCCAAGCCCACTCCTAGG + Intronic
1115855112 14:37622466-37622488 AAAGCCCCCAGTCATCGCCTCGG + Intronic
1117225174 14:53651007-53651029 AAAGCCACCAGTCCCCTCACGGG + Intergenic
1117559658 14:56923705-56923727 AAAGCCGCCAGTCCCATCATGGG - Intergenic
1120158594 14:81121299-81121321 AATGCCCTCAGCCTTCTCAATGG + Intronic
1120398430 14:83997700-83997722 AAATCCTCCAGCACTCACATGGG - Intergenic
1121251847 14:92505553-92505575 AAAGCTCCCAGCCCTCTGACAGG + Intergenic
1122801726 14:104234122-104234144 AAAGCCTCCAGGCCTGTGATGGG - Intergenic
1202904600 14_GL000194v1_random:60889-60911 AAAGCCCCCAGCCCTCTCATGGG + Intergenic
1123986357 15:25649784-25649806 GAATCCCCCAGGGCTCTCATGGG + Intergenic
1125891054 15:43267584-43267606 AAAGGCACAAGCCCTTTCATAGG + Intergenic
1128052340 15:64675255-64675277 AATGCCCCCAGCCCTTCCATTGG + Exonic
1129832710 15:78681225-78681247 CAAGCCCCCAGACTTCACATAGG - Intronic
1130928826 15:88405880-88405902 AAAGCTGCCAGTCCTATCATGGG + Intergenic
1131912627 15:97224519-97224541 CAAGCCCCCAGACCCCGCATGGG + Intergenic
1132630807 16:916404-916426 AAAGCTCCCAGCTCTCTCTGGGG - Intronic
1132889077 16:2195569-2195591 CAAGCTCCCAGCCCTTTCCTGGG + Intronic
1132925983 16:2429341-2429363 AACGCACCCGGCCCTCCCATTGG - Intergenic
1134188277 16:12100905-12100927 AAAGTCCCCAGCCCTCCCCCAGG - Intronic
1136472318 16:30489282-30489304 AAAGCCCCCAGCCCAGTCCTTGG - Exonic
1138189985 16:55006958-55006980 AAAGCCCCCAGCCATCTTCATGG + Intergenic
1140034318 16:71360972-71360994 AAAGCCCCCAGCCCACCCTTGGG + Intronic
1141697700 16:85627957-85627979 GAAGCCCCCAGCCCTCCCCAGGG - Intronic
1141886564 16:86896271-86896293 GAAGCCCCCAGCCCTCTACCTGG - Intergenic
1144192252 17:12857475-12857497 AAAGCCACCAGTCCTATCATGGG + Intronic
1144711489 17:17404304-17404326 AGACCCCTCAGCCCTCTGATGGG + Intergenic
1145267233 17:21385695-21385717 ACAGCCTCCAGGCCACTCATGGG + Intronic
1151351448 17:73534440-73534462 ATAGCCCCCAGGCCTCTCAGAGG - Intronic
1151448505 17:74182595-74182617 AAACAGCCCAGCCCTCTCAGAGG - Intergenic
1151571371 17:74927486-74927508 AAACCTCCTAGCCCTCTCTTTGG + Intronic
1152203492 17:78960854-78960876 AGAGCCCCCAGTCCTCTCCCTGG + Intergenic
1152231660 17:79117018-79117040 AAAGACCCCAGCCCTCCTCTTGG - Intronic
1153240016 18:3022605-3022627 AAAGCCACCAGTCCTAGCATGGG + Intergenic
1155364019 18:25032722-25032744 GCAGCACCCAGCCCTCGCATGGG + Intergenic
1156243556 18:35276415-35276437 TAAGCCCCAAGCCCTGTGATGGG - Intronic
1157847020 18:51013475-51013497 AAAGCCACCAGTCCCATCATAGG - Intronic
1163649990 19:18511680-18511702 AAAGCCCACAGCACTGTCAGAGG - Intronic
1163737680 19:18991400-18991422 AAAGCCCCCTACACTCTCAGAGG - Intronic
1167593916 19:50417767-50417789 ACAGCCCCCACCCCTCTCCCAGG + Intronic
925261861 2:2536147-2536169 AATGCCCGCAGCCCTTTCAGCGG + Intergenic
927175011 2:20399707-20399729 CCTGCCCCCAGCCCTTTCATGGG + Intergenic
927427534 2:22997319-22997341 AAAGCCACCAGTCCCATCATGGG - Intergenic
927774984 2:25895773-25895795 AAACTCCCCTTCCCTCTCATTGG - Intergenic
929598885 2:43192818-43192840 CAAGCCCCCAGCCCTCCTCTGGG - Intergenic
932424563 2:71620846-71620868 TAAGCCCCCAGCCCTCACACAGG - Intronic
934502041 2:94869506-94869528 AAAGCCCCCAGCCCTCTCATGGG - Intergenic
934915292 2:98296588-98296610 AAAGCCCTGTGTCCTCTCATGGG - Intronic
936076371 2:109404311-109404333 ACAGCTCCCAGCTCTCTCCTCGG - Intronic
940515320 2:154677153-154677175 AAAGCCACCAGTCCCATCATGGG - Intergenic
940623566 2:156144820-156144842 CAAGCCCCCATCTCTCACATTGG + Intergenic
948270632 2:236670663-236670685 GAAGACCCCAGCCCTCCCAGTGG - Intergenic
948342428 2:237265112-237265134 AAGGCCTCCAGCCCGCTCCTGGG + Intergenic
948612823 2:239180607-239180629 AAAGCCCCCAGCCCAGACAAGGG + Intronic
1171137564 20:22710338-22710360 AAAACCACCAGTCCTGTCATGGG + Intergenic
1173013285 20:39201648-39201670 AAATACCCCAGACCTCTGATTGG + Intergenic
1173093027 20:39993911-39993933 AAACCCGCCAGCCCTCTCCAGGG + Intergenic
1173174964 20:40757648-40757670 AGAGCCCCCAGCCTTCTAATGGG - Intergenic
1174058672 20:47817090-47817112 AAAGGCCCCACCCCTTTCCTGGG - Intergenic
1175182141 20:57156228-57156250 ACTGCCCCCAGCCCACTCCTTGG - Intergenic
1176248954 20:64110969-64110991 ACCGCCCCCGGCCCTCTCACTGG - Intergenic
1176623970 21:9075656-9075678 AAAGCCCCCAGCCCTTTCATGGG + Intergenic
1178839312 21:36126171-36126193 GAAGGCCCCAGTCCTCTCCTTGG - Intergenic
1179463697 21:41556499-41556521 CAATCCCCCAGCCCTCACAATGG + Intergenic
1179911212 21:44449897-44449919 AGAGCCCCCGGCCATCTCACAGG - Intergenic
1181171734 22:21013920-21013942 CCAGCCCCCTGCCCTCTCCTCGG - Intronic
1184694881 22:46133642-46133664 AAAGGCCCCAGCTCTCACTTGGG + Intergenic
1184701747 22:46179098-46179120 AAAGTCACCAGTCCTATCATGGG + Intronic
1185256905 22:49838936-49838958 AAGCCCCACAGCCCTCCCATAGG + Intergenic
949927581 3:9054136-9054158 TAAGCCCCCAGCCATCTGAATGG + Intronic
951053525 3:18121548-18121570 AGAGGCCCCAGCTCTCTCATAGG - Intronic
952653313 3:35752552-35752574 CTATCCCCAAGCCCTCTCATGGG + Intronic
954614842 3:51964283-51964305 TAAGCCCCCAGCCCTTTGATTGG - Intronic
959272531 3:104231380-104231402 AAAGCCACCAGTCCCATCATTGG + Intergenic
961171863 3:124802852-124802874 AAACCCCACAGCCCTCGCAGTGG + Intronic
961434571 3:126907921-126907943 AAAGCCACCAGGCCTGTCCTCGG + Intronic
966201918 3:177366683-177366705 AAAGCCCTCAGTATTCTCATTGG - Intergenic
966716083 3:183014079-183014101 AAAGCCACCAGTCCCATCATGGG + Intergenic
967839107 3:193990403-193990425 AAAGCCACCAGCCACATCATGGG + Intergenic
969209518 4:5676087-5676109 ACAGTACCCAGCCCTTTCATGGG + Intronic
970013497 4:11486425-11486447 TAAGCCTCGAGCCTTCTCATAGG - Intergenic
970219655 4:13797623-13797645 ACAGCCACCAGCACTCTAATTGG - Intergenic
971267007 4:25104684-25104706 AAATCACCCAGGACTCTCATGGG - Intergenic
972359790 4:38316284-38316306 CAACCCCCCAGCCCTCTCCTTGG + Intergenic
975718025 4:77224422-77224444 AAAACTCCCACCCCTCTCATGGG - Intronic
976759751 4:88535703-88535725 AAAGCCACCAGTCCCATCATGGG + Intronic
977498021 4:97801574-97801596 ACAGCACCCAGCCATGTCATTGG - Intronic
977518464 4:98051473-98051495 AAAGCCACTAGTCCTATCATGGG - Intronic
979840567 4:125434926-125434948 AAAGCTCCCAGAACTCTCAAAGG + Intronic
979927165 4:126582368-126582390 AAACCCACCTGCCCTTTCATTGG - Intergenic
981146228 4:141327968-141327990 CAAGCCCTCAGCTCTCACATGGG + Intergenic
981521109 4:145663455-145663477 TAAGCCCAGAGCCTTCTCATAGG + Intergenic
982767514 4:159365702-159365724 AAAACCACCAGCCTACTCATGGG + Intergenic
982800965 4:159707051-159707073 AAAGCCCCCAGATCTCTAGTGGG - Intergenic
989700269 5:44255613-44255635 AAAGCCACCAGTCCCATCATGGG - Intergenic
989972019 5:50536094-50536116 AAAGAAACCAGCCCTCTCAAAGG + Intergenic
991410750 5:66343175-66343197 CATGACCCCAGTCCTCTCATAGG + Intergenic
996542782 5:124647688-124647710 AACGCTCCCAGCCCTTCCATAGG - Exonic
997356747 5:133267337-133267359 CCAGCCCCAGGCCCTCTCATGGG - Intronic
998401659 5:141851709-141851731 AGAGCCCCCAGCCCCCTGGTTGG - Intergenic
1001318636 5:170662515-170662537 AAAGGCCCCAGTCCTCAGATTGG - Intronic
1001716404 5:173819840-173819862 AAAGCCACCAGTCCCATCATGGG + Intergenic
1003427785 6:6008906-6008928 AAAGCCTCCCGCCCTGCCATTGG - Intergenic
1003697510 6:8425152-8425174 GAGGCCCCCTCCCCTCTCATCGG + Intronic
1005887225 6:30106262-30106284 AGAGCCACCAGCCCAGTCATGGG + Intronic
1006432722 6:34007765-34007787 AAAGGCCCCACCACCCTCATGGG - Intergenic
1006725355 6:36196358-36196380 AACGTCCACAGCCCTCTTATCGG + Intergenic
1007215318 6:40232871-40232893 AAAGCCCCCAGTCATCTTCTTGG + Intergenic
1007719129 6:43875106-43875128 ACAGCCCTCAGGCCTCTCCTAGG - Intergenic
1010160128 6:72843999-72844021 ATAGCCCCCAGCCCACTGACAGG - Intronic
1011243072 6:85293264-85293286 CTAGCCCCCAACCCTCTGATAGG - Intergenic
1011780470 6:90783949-90783971 AAGCCCTCCAGCCTTCTCATAGG + Intergenic
1015439572 6:133232695-133232717 AAAGCCACCAGCCCCATCATGGG + Intergenic
1017029944 6:150212086-150212108 AAAGCCCCTTCCCCTCTCAAAGG - Intronic
1017976822 6:159365515-159365537 AAAGCCACCAGTCCCATCATGGG - Intergenic
1019435992 7:1022338-1022360 ACGTCCCACAGCCCTCTCATGGG + Intronic
1019658356 7:2209899-2209921 AATGCACTCAGCCCTCCCATGGG + Intronic
1022111804 7:27236532-27236554 AAAGCCCCTTCCCCTCTCCTGGG - Intergenic
1023110498 7:36806383-36806405 AAAGACCTCAGCCATCTTATGGG + Intergenic
1025635944 7:63318795-63318817 CCAGACCCCAGCCTTCTCATGGG + Intergenic
1025646752 7:63429385-63429407 CCAGACCCCAGCCTTCTCATGGG - Intergenic
1027058975 7:75070279-75070301 ACAGCGCCCAGCCCTCCCTTTGG - Intronic
1029649056 7:101878326-101878348 AAAGGACCCACCCCTCTCCTAGG - Intronic
1030522088 7:110610269-110610291 TAAGTCCCCAGTCCTCTCTTGGG - Intergenic
1031178166 7:118378966-118378988 AGAGCCCTCTGCCATCTCATTGG - Intergenic
1033564031 7:142561238-142561260 AGAGCCCCCACCATTCTCATGGG - Intergenic
1034082098 7:148288416-148288438 AAAGCCACCAGCCCCATCATAGG + Intronic
1035225117 7:157428477-157428499 AAAGCCCATAGCCTTCTCCTTGG + Intergenic
1037630579 8:20651924-20651946 AAATCCCCCAGCCTTCTGAGTGG - Intergenic
1037738281 8:21583853-21583875 GCAGCCCCCACCCCTCTCCTTGG + Intergenic
1038131471 8:24736822-24736844 AAAGCCACCAGTCTTCTCACTGG - Intergenic
1038405714 8:27320946-27320968 TAAGCCACCAGGCATCTCATTGG + Intronic
1040291601 8:46128338-46128360 GAAGCCCCCCGGCCTCTCCTGGG - Intergenic
1040341039 8:46441208-46441230 GAAGCCCCCAGCTCTTTCTTGGG - Intergenic
1041463664 8:58138247-58138269 GATGCCCCCAGCCTTCTCAGAGG + Intronic
1044115470 8:88328520-88328542 AGCGCCCCCATCCCTCTCATCGG - Intergenic
1046057365 8:109095141-109095163 AAAGCCCCTAGCACTATCCTAGG + Intronic
1048153973 8:131923940-131923962 AAAGCCCGCAGCACTGTGATTGG + Intronic
1052701161 9:31939497-31939519 AAAGCTCCAAGACCTTTCATTGG - Intergenic
1052796550 9:32928480-32928502 TAAGACCACAGCCCTCTCACTGG + Intergenic
1053001069 9:34577703-34577725 AGAGCCCCCTCCCCTCTCAGAGG + Intronic
1053462772 9:38283190-38283212 AAAGACCCCATCCCTCTCTGGGG + Intergenic
1057334937 9:94148250-94148272 AAAGTCCCCAGTTTTCTCATGGG - Intergenic
1057705542 9:97392512-97392534 CCAGACCTCAGCCCTCTCATGGG + Intergenic
1061822706 9:133237381-133237403 AAAGCCCCCAGCACTGCCAGAGG + Intergenic
1061865341 9:133489225-133489247 AAACCACACAGCCTTCTCATGGG - Intergenic
1062176230 9:135164488-135164510 CCACCCCCCAGCCCCCTCATCGG - Intergenic
1062317632 9:135976317-135976339 CCAGCCACCAGCCATCTCATCGG - Intergenic
1062371936 9:136244342-136244364 AAAGGCCCCAGCTCTCTAAGAGG + Intronic
1203747153 Un_GL000218v1:46084-46106 AAAGCCCCCAGCCCTCTCATGGG + Intergenic
1203562953 Un_KI270744v1:73396-73418 AAAGCCCCCAGCCCTCTCATGGG - Intergenic
1186980561 X:14953736-14953758 AAAGCCACCAGACCCATCATGGG + Intergenic
1188380370 X:29484334-29484356 AAAGCCACCAGTCCCATCATGGG + Intronic
1197271073 X:124425459-124425481 AAAGCCACCAGTCCCATCATGGG - Intronic
1197442060 X:126503804-126503826 AAAGCCAACAGCCCCATCATGGG + Intergenic
1197883218 X:131191102-131191124 AAGTACCCCTGCCCTCTCATCGG - Intergenic
1198338370 X:135690175-135690197 AAAGACCTCAGTCCTCTCATAGG - Intergenic
1198966838 X:142236769-142236791 TAAGCCTCCAGGCCTCTGATGGG - Intergenic
1199516435 X:148681799-148681821 AAAGCCCAAAGCCCTCTGGTGGG - Intronic
1199720705 X:150541124-150541146 AAGGCCCCGAGCCCTCACAGGGG - Intergenic
1201160474 Y:11161079-11161101 AAAGCCCCCAGCCCTCTCATGGG + Intergenic