ID: 1201160475

View in Genome Browser
Species Human (GRCh38)
Location Y:11161080-11161102
Sequence AAGCCCCCAGCCCTCTCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 5, 1: 2, 2: 1, 3: 19, 4: 219}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201160469_1201160475 -2 Left 1201160469 Y:11161059-11161081 CCTGCCAGCTGCAAAATCCCAAA No data
Right 1201160475 Y:11161080-11161102 AAGCCCCCAGCCCTCTCATGGGG 0: 5
1: 2
2: 1
3: 19
4: 219
1201160470_1201160475 -6 Left 1201160470 Y:11161063-11161085 CCAGCTGCAAAATCCCAAAGCCC No data
Right 1201160475 Y:11161080-11161102 AAGCCCCCAGCCCTCTCATGGGG 0: 5
1: 2
2: 1
3: 19
4: 219
1201160468_1201160475 5 Left 1201160468 Y:11161052-11161074 CCTGACTCCTGCCAGCTGCAAAA No data
Right 1201160475 Y:11161080-11161102 AAGCCCCCAGCCCTCTCATGGGG 0: 5
1: 2
2: 1
3: 19
4: 219
1201160467_1201160475 6 Left 1201160467 Y:11161051-11161073 CCCTGACTCCTGCCAGCTGCAAA No data
Right 1201160475 Y:11161080-11161102 AAGCCCCCAGCCCTCTCATGGGG 0: 5
1: 2
2: 1
3: 19
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201160475 Original CRISPR AAGCCCCCAGCCCTCTCATG GGG Intergenic
900302652 1:1985812-1985834 AAGCCCCAAGCCCTCGCGTCAGG + Intronic
900557957 1:3289516-3289538 AAGCCCCCAGCCCTGGCACAGGG - Intronic
900799256 1:4727358-4727380 TTGCCTCCAGCCCTCTCCTGTGG + Intronic
902106378 1:14039493-14039515 AAGCCCACTGCCGACTCATGTGG - Intergenic
902632249 1:17711896-17711918 TGGCCCCCTTCCCTCTCATGTGG - Intergenic
903189883 1:21650604-21650626 GAGCCCCCAGCCCTGCCCTGCGG - Intronic
905491543 1:38348115-38348137 AAGCCACCAGTCCCATCATGAGG + Intergenic
905650104 1:39650588-39650610 AAGCCAACAGCCATGTCATGAGG + Intergenic
907329763 1:53663339-53663361 CAGCCCCCAGGCCTCTGATATGG - Intronic
908288926 1:62641482-62641504 AAGCCCCCAGCCACCTCTTTTGG - Intronic
910469894 1:87540459-87540481 AAGCCACCAGTCCTCTCATAAGG - Intergenic
916173445 1:162019402-162019424 AAGCCCTCAGCCAACCCATGGGG + Intronic
919130152 1:193440980-193441002 AAGCCACCAGTTCTATCATGGGG - Intergenic
921222917 1:212986510-212986532 TAGCCCTCAGCCCACTAATGTGG - Intronic
922652631 1:227354396-227354418 AAGTCTCCAGCCCCCTCCTGTGG - Intergenic
1063497195 10:6520805-6520827 CAGCTCTCAGCCCTCTAATGTGG + Intronic
1071566587 10:86674379-86674401 CAGCCCCCAGCACTCACAAGTGG + Intronic
1073618861 10:105026256-105026278 AAGCCACCAGCCCTCTCCCCTGG + Intronic
1074544646 10:114393227-114393249 AAGCCACCAACACTCTCCTGGGG + Intronic
1077303802 11:1858914-1858936 AAGCCCCTGGCCCTTTCTTGGGG + Intronic
1078762828 11:14265134-14265156 GAAGCCCCAGCCATCTCATGAGG - Intronic
1080375516 11:31705297-31705319 AAGCCACCAGTCCCATCATGGGG + Intronic
1081038505 11:38180405-38180427 AAGCCAACAGCCATATCATGAGG + Intergenic
1084319676 11:68366306-68366328 AAGCCCCCTGCCCTCCCGAGTGG - Intronic
1084416030 11:69033496-69033518 AAGCCCCCACCCATCTCCAGCGG - Intergenic
1084717738 11:70884186-70884208 CAGCCCCGAGCCCTCTCTGGTGG - Intronic
1084767903 11:71324366-71324388 AGGCTCCCTGCCCTCTCATCTGG - Intergenic
1084942095 11:72618372-72618394 AAACCCCCAGCCCTCTCCCCTGG + Intronic
1085376788 11:76070818-76070840 ATTCCCCCAGCCCTCTAATGTGG - Intronic
1087072153 11:94091683-94091705 AAGCACACAGCCCTGTCTTGAGG + Intronic
1088585600 11:111357749-111357771 TGGCCCCCAGGCCTCTCATCTGG - Intronic
1091780759 12:3213322-3213344 CTGCCCCCTGCCCTCTCAAGGGG + Intronic
1093310400 12:17575098-17575120 AAGCCACCACTCCTCTCATATGG + Intergenic
1094253967 12:28400215-28400237 AAGCCCCAAGCCTTGGCATGTGG - Intronic
1096981064 12:55728516-55728538 TCGCCCCCACCCCTCTCCTGCGG - Intronic
1098012594 12:66070828-66070850 AAGCCTCCAGTCCCATCATGGGG - Intergenic
1098355730 12:69610833-69610855 ATGCCCCCAGCCTCCGCATGGGG - Exonic
1100367971 12:93938795-93938817 AAGCCCCCAGTCCCCTCTTAAGG - Intergenic
1101735627 12:107460751-107460773 CAACCCCCAGCCCCCTGATGTGG - Intronic
1102046232 12:109832075-109832097 AAGCCCCCAGGGCTGTCGTGAGG - Intronic
1102892208 12:116568677-116568699 AAGCCACCAGTCCCATCATGGGG - Intergenic
1102951187 12:117032781-117032803 AAGGACCAAGCCCTCTCTTGGGG - Intergenic
1103131007 12:118468618-118468640 AAGCCACCAGTCCCATCATGGGG + Intergenic
1103991174 12:124800397-124800419 AAGCCCCAGGCCCTGTGATGAGG + Intronic
1104074512 12:125377333-125377355 AAGTTCCCTGCCCTCTGATGTGG - Intronic
1104351619 12:128049042-128049064 TAGCCTCCAGAGCTCTCATGAGG + Intergenic
1105015334 12:132783330-132783352 AAGAGCCCAGCCTTCTCCTGGGG + Intronic
1107523492 13:41206191-41206213 AAGCCACCAGTCCCATCATGGGG - Intergenic
1110177452 13:72573989-72574011 ATGTACCCAGCCCTCTTATGTGG - Intergenic
1113412470 13:110102268-110102290 AAGCCACCTGCCATGTCATGAGG + Intergenic
1113521994 13:110947786-110947808 AGGCCCCCCACCCTCTCGTGGGG - Intergenic
1113705898 13:112432910-112432932 AGGCCCCCCACCCTCTCGTGGGG + Intronic
1113706409 13:112436122-112436144 GAGCCCCAGGCCCACTCATGTGG - Intergenic
1114064672 14:19051062-19051084 AATCCCCCTGCCCTCTCTGGTGG - Intergenic
1114097589 14:19348940-19348962 AATCCCCCTGCCCTCTCTGGTGG + Intergenic
1115951720 14:38728598-38728620 TAGCCCTCAGCCCACTCACGGGG + Intergenic
1117119584 14:52553131-52553153 CGGCCCCCAGCCCCCTCATGAGG + Exonic
1117559657 14:56923704-56923726 AAGCCGCCAGTCCCATCATGGGG - Intergenic
1120398429 14:83997699-83997721 AATCCTCCAGCACTCACATGGGG - Intergenic
1120932385 14:89861706-89861728 AAGCCAATAGTCCTCTCATGAGG - Intronic
1121251848 14:92505554-92505576 AAGCTCCCAGCCCTCTGACAGGG + Intergenic
1122235336 14:100328040-100328062 AAGCCCCCAGCACACATATGTGG + Intronic
1122790767 14:104183275-104183297 AAGCCCTCAGCCCTGTCATTAGG + Intergenic
1122957093 14:105075943-105075965 CAGCCGCCAGCCCTCCCGTGGGG - Intergenic
1202904601 14_GL000194v1_random:60890-60912 AAGCCCCCAGCCCTCTCATGGGG + Intergenic
1124837590 15:33210133-33210155 AATCCCCCAGTCCCATCATGGGG - Intergenic
1130928827 15:88405881-88405903 AAGCTGCCAGTCCTATCATGGGG + Intergenic
1132889078 16:2195570-2195592 AAGCTCCCAGCCCTTTCCTGGGG + Intronic
1133352141 16:5108680-5108702 AAGTCCCCAGCCCTGCCCTGCGG + Intergenic
1133469640 16:6062290-6062312 AGCCCCCCTGCCCTCTCAAGAGG + Intronic
1135388384 16:22066117-22066139 AAACCCCCTGCCCTCTCAATTGG - Intronic
1135651350 16:24209325-24209347 AAGCCACCATTCCTCTCCTGTGG + Intronic
1140034319 16:71360973-71360995 AAGCCCCCAGCCCACCCTTGGGG + Intronic
1140455374 16:75102294-75102316 AACCCACAAGCCCACTCATGAGG + Intronic
1141386355 16:83625513-83625535 AAGCAGACAGCCCTGTCATGGGG - Intronic
1141665035 16:85461646-85461668 AAGCCCCCACCCCTTTAATTAGG + Intergenic
1143176770 17:4959960-4959982 AAACCCCCACCCCTCCCAGGTGG + Intronic
1147534427 17:41309868-41309890 AAACCACCAGCAATCTCATGAGG + Intergenic
1148244255 17:46020231-46020253 AAGGCCCCAGCAGCCTCATGTGG - Intronic
1149991893 17:61388061-61388083 GAGCCCCCAGCACTCTCTTTCGG + Intronic
1150072890 17:62167680-62167702 AAGCATCCAGCCCTTTCTTGTGG - Intergenic
1150606073 17:66692071-66692093 AAGTCCACAGCCCTCCCAGGAGG - Intronic
1151075666 17:71269452-71269474 AAACCCCCAGTCCTATTATGAGG - Intergenic
1151313848 17:73310435-73310457 AAGCCCCCTGCCCTCCCCTGAGG - Intronic
1152015594 17:77748513-77748535 AAGGCCCCAGCTCTGTTATGTGG - Intergenic
1152260928 17:79266700-79266722 CAGCCCCCTCCCCTCTCCTGAGG - Intronic
1153240017 18:3022606-3022628 AAGCCACCAGTCCTAGCATGGGG + Intergenic
1154173686 18:12068010-12068032 CCGCCCCCAGCCCTGTGATGGGG - Intergenic
1156921632 18:42529404-42529426 GGGCCCACATCCCTCTCATGAGG - Intergenic
1160250855 18:77202536-77202558 AAGACCCCTGCCCGGTCATGAGG - Intergenic
1161437536 19:4272879-4272901 CAGCCCCCAGTTCTCTCCTGGGG + Intergenic
1162299212 19:9834885-9834907 AAGCCCCCAGCCCTCCCATGCGG - Intergenic
1162365113 19:10243798-10243820 ATGCAACCAGCCCTCTCCTGTGG - Intergenic
1163657986 19:18558847-18558869 AACCCCTCAGCCCTCACATCTGG + Intronic
1165793262 19:38504906-38504928 CAGCCCCCAGGCCTCACTTGAGG - Exonic
1166915187 19:46190691-46190713 AATCCCCCAACCCTCTCCTGTGG + Intergenic
1167743596 19:51338869-51338891 AAGCCCCGCGCCCTCTCACCCGG + Exonic
925274285 2:2637875-2637897 TAGCCCCCAGCCCTCTGTTTTGG + Intergenic
926133340 2:10319285-10319307 AAGCCTCCAGGCCTCTCCTATGG - Intronic
927427533 2:22997318-22997340 AAGCCACCAGTCCCATCATGGGG - Intergenic
928110380 2:28503637-28503659 AAGTCCCCAGACATCTCATTTGG - Intronic
928188864 2:29143067-29143089 CAGCCCCCTGCCCATTCATGGGG - Intronic
928339902 2:30433864-30433886 GAGCCCCCAGCCCTCCACTGGGG - Intergenic
931431994 2:62215697-62215719 AAGCCCCCTGCCATATCACGAGG - Intronic
932612220 2:73208322-73208344 AAGCCCCCTGCACTCCCATCTGG - Intronic
933588011 2:84200875-84200897 GAGCCCCCAGCAGTCACATGAGG - Intergenic
933809986 2:86027143-86027165 GAGGCCCCAGCCATCTCAGGGGG + Exonic
934502040 2:94869505-94869527 AAGCCCCCAGCCCTCTCATGGGG - Intergenic
934915291 2:98296587-98296609 AAGCCCTGTGTCCTCTCATGGGG - Intronic
935213702 2:100959290-100959312 AAAGCCCCAGCTCTCTCTTGTGG + Intronic
935373816 2:102375193-102375215 CAGCCCCCAGACATCCCATGTGG + Intronic
937036364 2:118785917-118785939 AATCCCCCAAACCTCTCCTGTGG + Intergenic
937696945 2:124818697-124818719 AGGCCCCCTGCCCTCTCCTCTGG + Intronic
937869697 2:126778301-126778323 AAGCCCCCTCCCAACTCATGTGG + Intergenic
937922559 2:127141509-127141531 AAGCCCACTGCCGTCCCATGCGG + Intergenic
938481951 2:131670094-131670116 AATCCCCCTGCCCTCTCTGGTGG - Intergenic
940515319 2:154677152-154677174 AAGCCACCAGTCCCATCATGGGG - Intergenic
946187584 2:217989731-217989753 GACGCCCCAGCCCTCTCCTGTGG - Intronic
946379846 2:219339668-219339690 AAGCCACCAGTCCCATCATGCGG - Intergenic
947199010 2:227598246-227598268 AAGCCCACAGCCCTCAGATCCGG - Intergenic
948058226 2:235025359-235025381 GGGCCCCCACCCCTCTCCTGTGG + Intronic
948270631 2:236670662-236670684 AAGACCCCAGCCCTCCCAGTGGG - Intergenic
949003610 2:241632795-241632817 AAGCTCCCTGCGCTCTCAGGAGG - Intronic
949045597 2:241871426-241871448 TAGCCCGCAGCCCCCTCATGTGG - Intronic
1169232036 20:3896596-3896618 AAGCCCCCACCCCTCCCCAGAGG - Intronic
1170394999 20:15916289-15916311 AAGCCAGCTGCCATCTCATGAGG - Intronic
1171137565 20:22710339-22710361 AAACCACCAGTCCTGTCATGGGG + Intergenic
1171727668 20:28640513-28640535 AAGCCCCTAGCACTCTTATATGG - Intergenic
1172356322 20:34282811-34282833 AAGCCTCTAACTCTCTCATGAGG + Intronic
1173576175 20:44114181-44114203 CAGCCCCCAGCTCCATCATGGGG + Intronic
1174200211 20:48801814-48801836 ATGGCACCAGCCCACTCATGAGG - Intronic
1175854890 20:62115335-62115357 CAGCCCACAGCCCTCTCACTTGG + Intergenic
1176038814 20:63053474-63053496 AAGTTCTCAGCCCTCCCATGGGG + Intergenic
1176039319 20:63056066-63056088 AGCCCCCCAGCCCTGTCCTGAGG - Intergenic
1176407608 21:6430004-6430026 AAGCCCACAGCCCGCTCACCTGG - Intergenic
1176623971 21:9075657-9075679 AAGCCCCCAGCCCTTTCATGGGG + Intergenic
1178839311 21:36126170-36126192 AAGGCCCCAGTCCTCTCCTTGGG - Intergenic
1179683099 21:43038335-43038357 AAGCCCACAGCCCGCTCACCTGG - Intergenic
1180392005 22:12292941-12292963 AAGCCCCTAGCACTCTTATATGG - Intergenic
1180407740 22:12571815-12571837 AAGCCCCTAGCACTCTTATATGG + Intergenic
1180483160 22:15773684-15773706 AATCCCCCTGCCCTCTCTGGTGG - Intergenic
1181466774 22:23114653-23114675 CAGCCCTCAGCCCCCTCACGAGG + Intronic
1181740812 22:24920012-24920034 AAGCCTGCACCCCTCTCATGAGG - Intronic
1181805736 22:25373562-25373584 AAGCCCCCTGCCCTCCCAAGTGG + Intronic
1183933448 22:41248859-41248881 CAGCCCCGGGCCCTCTCCTGGGG - Intronic
1184694882 22:46133643-46133665 AAGGCCCCAGCTCTCACTTGGGG + Intergenic
1184701748 22:46179099-46179121 AAGTCACCAGTCCTATCATGGGG + Intronic
950967443 3:17155960-17155982 AAGCCACCAGCACTCACATCAGG + Intergenic
951053524 3:18121547-18121569 GAGGCCCCAGCTCTCTCATAGGG - Intronic
952765012 3:36945782-36945804 AAGCCCGCCGCCCTCCCCTGGGG + Intergenic
953044262 3:39281119-39281141 CAGCCCCCAGCTCTGTCCTGGGG - Intronic
953372907 3:42405522-42405544 AGGCCTGCAGCCTTCTCATGTGG - Intronic
953928779 3:46995849-46995871 GAGACCCCATCCTTCTCATGTGG + Intronic
953962959 3:47281253-47281275 AAGCCCACAGCCCTTCCAGGAGG + Intronic
954614841 3:51964282-51964304 AAGCCCCCAGCCCTTTGATTGGG - Intronic
954658856 3:52215635-52215657 AGGCACCCAGACCTCTCCTGTGG + Intergenic
954746963 3:52792845-52792867 AAGTCCCCAGCCATCCCTTGAGG + Intergenic
955387131 3:58488923-58488945 AATCCCCCAGCCATCTCATGAGG + Intergenic
956752202 3:72352327-72352349 AAGCTCCCATCTCTCTCTTGGGG + Intergenic
959064191 3:101640584-101640606 ACGCCCCCTGCCCTCACATTAGG + Intergenic
960520750 3:118652179-118652201 AAATGACCAGCCCTCTCATGTGG - Intergenic
962748198 3:138413199-138413221 AAGCCCCCAGACTACACATGAGG - Intergenic
966716084 3:183014080-183014102 AAGCCACCAGTCCCATCATGGGG + Intergenic
967839108 3:193990404-193990426 AAGCCACCAGCCACATCATGGGG + Intergenic
968485247 4:857694-857716 AAGCCCACAGACCTCTCCCGGGG - Intronic
970229275 4:13891929-13891951 AAGCCATCAACCCTCACATGAGG - Intergenic
971687499 4:29787713-29787735 AAACCTCCAGGCCTCTGATGTGG + Intergenic
972359791 4:38316285-38316307 AACCCCCCAGCCCTCTCCTTGGG + Intergenic
973265770 4:48208668-48208690 AAGGCCCCATCTCTCTCATGCGG + Intronic
976759752 4:88535704-88535726 AAGCCACCAGTCCCATCATGGGG + Intronic
977518463 4:98051472-98051494 AAGCCACTAGTCCTATCATGGGG - Intronic
980899770 4:138893725-138893747 AAGCCGCCAGCCTCATCATGAGG + Intergenic
981752220 4:148103330-148103352 TAGGCCCCAGGTCTCTCATGTGG + Intronic
985432915 4:189898535-189898557 AAGCCCCTAGCACTCTTATATGG + Intergenic
986121377 5:4839413-4839435 AAGCCTACATCCCTCTCTTGTGG + Intergenic
987101703 5:14596867-14596889 CAGCCACCAGTCCTGTCATGGGG + Intronic
987218074 5:15760148-15760170 AAGCCTCCAGCCCCCTATTGGGG + Intronic
988625767 5:32872803-32872825 AAGGCCCCTGCCCCCACATGTGG - Intergenic
989700268 5:44255612-44255634 AAGCCACCAGTCCCATCATGGGG - Intergenic
991443190 5:66672898-66672920 TATCCCCCAGCCCTTACATGAGG + Intronic
998392682 5:141797456-141797478 ATGCTCCCTGCCCTGTCATGGGG + Intergenic
999737522 5:154523790-154523812 CGCCCCCCAGCCCTCTCATCTGG + Intergenic
1000861091 5:166456864-166456886 GAACCCCCTGCCCTGTCATGGGG - Intergenic
1001406831 5:171482488-171482510 AACCCCACAGCCCCCTCATGTGG - Intergenic
1001716405 5:173819841-173819863 AAGCCACCAGTCCCATCATGGGG + Intergenic
1002543310 5:179920746-179920768 TGCCCCCCAGCCCTCTCATCTGG + Intronic
1002788456 6:421507-421529 AAGCCACCAGTCCCATCATGGGG + Intergenic
1003697511 6:8425153-8425175 AGGCCCCCTCCCCTCTCATCGGG + Intronic
1005734075 6:28729289-28729311 AAGCCAACAGAACTCTCATGCGG + Intergenic
1005887226 6:30106263-30106285 GAGCCACCAGCCCAGTCATGGGG + Intronic
1015439573 6:133232696-133232718 AAGCCACCAGCCCCATCATGGGG + Intergenic
1016851129 6:148620070-148620092 AAGGACCCACCCCTATCATGTGG + Intergenic
1016851527 6:148624099-148624121 AAGGACCCACCCCTATCATGTGG + Intergenic
1018988819 6:168658073-168658095 AGTCCCCCAGGCCTCCCATGTGG - Intronic
1019316881 7:391009-391031 AGCCCCCCAGCCCTCTCAGGAGG - Intergenic
1019435993 7:1022339-1022361 CGTCCCACAGCCCTCTCATGGGG + Intronic
1019658357 7:2209900-2209922 ATGCACTCAGCCCTCCCATGGGG + Intronic
1020942767 7:14561957-14561979 AGGCCCCCAGGCCTGTGATGAGG - Intronic
1024487765 7:49938675-49938697 AAGACCCCAGCCCAATTATGAGG - Intronic
1024823997 7:53367630-53367652 AAGTCCCCAGCCTGCCCATGTGG - Intergenic
1026547911 7:71340052-71340074 AAACCCCCACCCACCTCATGTGG - Intronic
1026604609 7:71805113-71805135 GAGCTCCCAGCCCTCTGATGTGG + Intronic
1026625404 7:71987609-71987631 AAGCCCAGTCCCCTCTCATGGGG - Intronic
1032751895 7:134849797-134849819 AAGCCGCAGGGCCTCTCATGGGG + Intronic
1034082099 7:148288417-148288439 AAGCCACCAGCCCCATCATAGGG + Intronic
1034423789 7:151002512-151002534 ACGCTCCCAGCCCACCCATGTGG + Intronic
1034990487 7:155544845-155544867 GAGAGCCCAGCCCTCTCCTGTGG + Intergenic
1036810182 8:11862619-11862641 TGGCCCCCAGCACTCTGATGTGG + Intronic
1037333915 8:17773656-17773678 AAGCCACCAGTCCCATCATGGGG + Intronic
1037767935 8:21783229-21783251 CAGCCCCCAGCTCTCTGCTGAGG - Intronic
1038059925 8:23901684-23901706 CCGCCCCCAACTCTCTCATGCGG - Intergenic
1038530979 8:28317711-28317733 AAGACCCTGGCCCCCTCATGAGG + Intronic
1040338505 8:46428194-46428216 AAGCCCCCAGGGCTGTCCTGTGG + Intergenic
1041409811 8:57541041-57541063 GAGCCCCCATCCCCCTCATTAGG - Intergenic
1043778775 8:84305928-84305950 AAAGCCCCACCCCTATCATGAGG + Intronic
1047836251 8:128696566-128696588 AAGCCCACAGCCCTCCCAGGAGG + Intergenic
1049064434 8:140301802-140301824 CAGCCCCCAGCTCTCTCCTTCGG + Intronic
1049092261 8:140525039-140525061 CAGCCCCCAGCCCCCTTTTGGGG - Intergenic
1049585944 8:143432441-143432463 TAGCCCCAAGGCCTCTCCTGGGG - Intergenic
1052051134 9:23850693-23850715 AAGCCCCCTGCCCTCCCCTCAGG + Intergenic
1053722073 9:40956563-40956585 AAGCCCCTAGCACTCTTATACGG + Intergenic
1054343898 9:63895410-63895432 AAGCCCCTAGCACTCTTATATGG - Intergenic
1056080354 9:83086757-83086779 AAGCCAGCAGTCTTCTCATGAGG - Intergenic
1056752761 9:89364007-89364029 AACCCCCCTGCACCCTCATGGGG - Intronic
1056815642 9:89798961-89798983 AAGCCCCCAGCACCCTACTGTGG - Intergenic
1057214542 9:93220639-93220661 CAGCCCCCAGCCCCCTCCTCAGG - Intronic
1059287063 9:113183183-113183205 ACTCCCCCAGCTCTGTCATGTGG + Intronic
1059647964 9:116286032-116286054 AAGCCCCCACCCCTTTTGTGGGG - Intronic
1060656327 9:125374953-125374975 CAGCCCTCAGCCCTCTCTGGAGG + Intergenic
1061429281 9:130520990-130521012 CCGCTCCCAGCCCTCCCATGGGG - Intergenic
1061561679 9:131408193-131408215 AAGGCCCGAGACCTCTCATTAGG - Intronic
1061924685 9:133800247-133800269 AGGCCCCCAGCCCACCCCTGTGG + Intronic
1203747154 Un_GL000218v1:46085-46107 AAGCCCCCAGCCCTCTCATGGGG + Intergenic
1203453098 Un_GL000219v1:139395-139417 AAGCCCCTAGCACTCTTATATGG - Intergenic
1203562952 Un_KI270744v1:73395-73417 AAGCCCCCAGCCCTCTCATGGGG - Intergenic
1186980562 X:14953737-14953759 AAGCCACCAGACCCATCATGGGG + Intergenic
1188380371 X:29484335-29484357 AAGCCACCAGTCCCATCATGGGG + Intronic
1192506186 X:71685165-71685187 GAGCCACCAGCCCTGCCATGGGG - Intergenic
1192520511 X:71796383-71796405 GAGCCACCAGCCCTGCCATGGGG + Intergenic
1197271072 X:124425458-124425480 AAGCCACCAGTCCCATCATGGGG - Intronic
1197442061 X:126503805-126503827 AAGCCAACAGCCCCATCATGGGG + Intergenic
1199516434 X:148681798-148681820 AAGCCCAAAGCCCTCTGGTGGGG - Intronic
1199538738 X:148933516-148933538 AAGCCACCATCCTTCTCATTTGG - Intronic
1199793312 X:151174889-151174911 AAGCCCCCACCCCAATCCTGCGG - Intergenic
1200120514 X:153788045-153788067 AAGCCCCCAGCCCGCACACCCGG + Intronic
1201160475 Y:11161080-11161102 AAGCCCCCAGCCCTCTCATGGGG + Intergenic