ID: 1201160482

View in Genome Browser
Species Human (GRCh38)
Location Y:11161097-11161119
Sequence ATGGGGTGAAGACACCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201160467_1201160482 23 Left 1201160467 Y:11161051-11161073 CCCTGACTCCTGCCAGCTGCAAA No data
Right 1201160482 Y:11161097-11161119 ATGGGGTGAAGACACCCTGAAGG No data
1201160477_1201160482 -10 Left 1201160477 Y:11161084-11161106 CCCCAGCCCTCTCATGGGGTGAA 0: 5
1: 1
2: 0
3: 9
4: 185
Right 1201160482 Y:11161097-11161119 ATGGGGTGAAGACACCCTGAAGG No data
1201160469_1201160482 15 Left 1201160469 Y:11161059-11161081 CCTGCCAGCTGCAAAATCCCAAA No data
Right 1201160482 Y:11161097-11161119 ATGGGGTGAAGACACCCTGAAGG No data
1201160468_1201160482 22 Left 1201160468 Y:11161052-11161074 CCTGACTCCTGCCAGCTGCAAAA No data
Right 1201160482 Y:11161097-11161119 ATGGGGTGAAGACACCCTGAAGG No data
1201160471_1201160482 -2 Left 1201160471 Y:11161076-11161098 CCCAAAGCCCCCAGCCCTCTCAT 0: 5
1: 1
2: 2
3: 26
4: 290
Right 1201160482 Y:11161097-11161119 ATGGGGTGAAGACACCCTGAAGG No data
1201160476_1201160482 -9 Left 1201160476 Y:11161083-11161105 CCCCCAGCCCTCTCATGGGGTGA 0: 5
1: 1
2: 0
3: 15
4: 217
Right 1201160482 Y:11161097-11161119 ATGGGGTGAAGACACCCTGAAGG No data
1201160470_1201160482 11 Left 1201160470 Y:11161063-11161085 CCAGCTGCAAAATCCCAAAGCCC No data
Right 1201160482 Y:11161097-11161119 ATGGGGTGAAGACACCCTGAAGG No data
1201160472_1201160482 -3 Left 1201160472 Y:11161077-11161099 CCAAAGCCCCCAGCCCTCTCATG 0: 5
1: 1
2: 2
3: 39
4: 409
Right 1201160482 Y:11161097-11161119 ATGGGGTGAAGACACCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201160482 Original CRISPR ATGGGGTGAAGACACCCTGA AGG Intergenic
No off target data available for this crispr