ID: 1201165034

View in Genome Browser
Species Human (GRCh38)
Location Y:11201359-11201381
Sequence TGACACATTCAGCCACAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201165034_1201165041 23 Left 1201165034 Y:11201359-11201381 CCTCACTGTGGCTGAATGTGTCA No data
Right 1201165041 Y:11201405-11201427 ACCTGATTCAGTCCTCACTGTGG No data
1201165034_1201165038 -8 Left 1201165034 Y:11201359-11201381 CCTCACTGTGGCTGAATGTGTCA No data
Right 1201165038 Y:11201374-11201396 ATGTGTCAGGGGCAGACGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201165034 Original CRISPR TGACACATTCAGCCACAGTG AGG (reversed) Intergenic
No off target data available for this crispr