ID: 1201165038

View in Genome Browser
Species Human (GRCh38)
Location Y:11201374-11201396
Sequence ATGTGTCAGGGGCAGACGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201165033_1201165038 3 Left 1201165033 Y:11201348-11201370 CCTGATTCAGTCCTCACTGTGGC No data
Right 1201165038 Y:11201374-11201396 ATGTGTCAGGGGCAGACGACAGG No data
1201165034_1201165038 -8 Left 1201165034 Y:11201359-11201381 CCTCACTGTGGCTGAATGTGTCA No data
Right 1201165038 Y:11201374-11201396 ATGTGTCAGGGGCAGACGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201165038 Original CRISPR ATGTGTCAGGGGCAGACGAC AGG Intergenic
No off target data available for this crispr