ID: 1201171769

View in Genome Browser
Species Human (GRCh38)
Location Y:11273646-11273668
Sequence GCAGCCAGGAAGTTCAAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201171769_1201171772 0 Left 1201171769 Y:11273646-11273668 CCCAGTTTGAACTTCCTGGCTGC No data
Right 1201171772 Y:11273669-11273691 TTTGTTTACTTACTCAAGCCTGG No data
1201171769_1201171775 11 Left 1201171769 Y:11273646-11273668 CCCAGTTTGAACTTCCTGGCTGC No data
Right 1201171775 Y:11273680-11273702 ACTCAAGCCTGGGCAATGGCAGG 0: 59
1: 785
2: 2481
3: 1672
4: 3692
1201171769_1201171774 7 Left 1201171769 Y:11273646-11273668 CCCAGTTTGAACTTCCTGGCTGC No data
Right 1201171774 Y:11273676-11273698 ACTTACTCAAGCCTGGGCAATGG No data
1201171769_1201171773 1 Left 1201171769 Y:11273646-11273668 CCCAGTTTGAACTTCCTGGCTGC No data
Right 1201171773 Y:11273670-11273692 TTGTTTACTTACTCAAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201171769 Original CRISPR GCAGCCAGGAAGTTCAAACT GGG (reversed) Intergenic
No off target data available for this crispr